inheritance essay questions with answers

NCERT Solutions for Class 6, 7, 8, 9, 10, 11 and 12

Molecular Basis of Inheritance Class 12 Important Questions and Answers Biology Chapter 6

August 1, 2022 by Bhagya

We have given these  Class 12 Biology Important Questions Chapter 6 Molecular Basis of Inheritance to solve different types of questions in the exam. Go through these Class 12 Biology Chapter 6 Important Questions, Molecular Basis of Inheritance Important Questions & Previous Year Questions to score good marks in the board examination.

Class 12 Biology Chapter 6 Important Questions Molecular Basis of Inheritance

Question 1. Write the dual purpose served by deoxyribonucleoside triphosphates in polymerisation. (2018) Answer: Deoxyribonucleoside Triphosphates (dNTPs) serve the dual purpose of

• acting as a substrate.
• providing energy (from two terminal phosphates).

Question 2. Why does hnRNA undergo splicing? Where does splicing occur in the cell? (Delhi 2015C) Answer: hnRNA undergoes splicing to remove non-coding sequences, i.e. introns and joins exons. Splicing occurs in the nucleus of the cell.

Question 3. Name the enzyme that transcribes hnRNA in eukaryotes. (Delhi 2015C) Or Write the function of RNA polymerase-II. (Foreign 2015) Answer: The RNA polymerase-II transcribes the precursor of mRNA, i.e. the heterogeneous nuclear RNA (hnRNA).

Question 4. Why is RNA more reactive in comparison to DNA? (Delhi 2015C) Answer: The OH-group in the ribose of RNA at 3’end makes the molecule more reactive, compared with DNA. RNA is also not stable under alkaline conditions.

Question 5. Name the negatively charged and positively charged components of a nucleosome. (Delhi 2015C) Or Name the positively charged protein around which the negatively charged DNA wrapped. (All India 2012C) Answer: Histone proteins forming an octamer is the positively charged component and the DNA helix is the negatively charged component of nucleosome.

Question 6. What is cistron? (All India 2015) Answer: The segment of DNA coding for a polypeptide is known as cistron.

Question 7. Name the transcriptionally active region of chromatin in a nucleus. (Delhi 2015) Answer: Euchromatin (lightly stained) is the transcriptionally active region of chromatin in a nucleus.

Question 8. What will happen if DNA replication is not followed by cell division in a eukaryotic cell? (All India 2014C) Answer: If cell division is not followed after DNA replication then replicated chromosomes (DNA) would not be distributed to daughter nuclei. A repeated replication of DNA without any cell division results in the accumulation of DNA inside the cell. This would increase the volume of the cell nucleus, thereby causing cell expansion. Further, it will lead to polyploidy.

Question 9. Why is it not possible for an alien DNA to become part of chromosome anywhere along its length and replicate normally? (All India 2014) Answer: An alien DNA cannot become a part of chromosome anywhere along its length and replicate normally due to the absence of origin of replication where the replication process is initiated.

Question 10. Name the enzyme and state its property that is responsible for continuous and discontinuous replication of the two strands of a DNA molecule. (Delhi 2013) Answer: DNA-dependent DNA polymerase This enzyme can polymerise deoxynucleotides in 5′ → 3′ direction only. Due to this, replication of DNA is continuous in one strand with polarity 3′ → 5’while discontinuous in another polarity 5′ → 3′.

Question 11. Name the enzyme that joins the small fragment of DNA of a lagging strand during DNA replication. (Delhi 2013C) Answer: DNAligase.

Question 12. Which one of an intron and an exon is the reminiscent of antiquity? (All India 2013C) Answer: Intron is considered to be the reminiscent of antiquity because these are non-coding sequences. (1)

Question 13. Name the specific components and the linkage between them that forms deoxyadenosine. (Delhi 2013C) Answer: The specific components of deoxyadenosine are adenine and deoxyribose. These are linked by N-glycosidic linkage.

Question 14. Which one out of rho factor and sigma factor acts as an initiation factor during transcription in a prokaryote? (Delhi 2013C) Answer: Sigma factor acts as an initiation factor and binds to the promoter during transcription in prokaryotes.

Question 15. Name the enzyme involved in continuous replication of DNA strand. Mention the polarity of the template strand. (All India 2012) Answer: Enzyme involved in continuous replication of DNA strand is DNA polymerase. Template strand has 3′ → 5′ polarity.

Question 16. Name the two basic amino acids that provide positive charges to histone proteins. (Delhi 2012C) Answer: Lysine and arginine.

Question 17. If the base adenine constitutes 31% of an isolated DNA fragment, then what is the expected percentage of the base cytosine in it? (Delhi 2011c) Answer: According to Chargaff’s rule A + G = C+ T = 50% ∴ if A = 31% then T = 31%; C + T = 50% ∴ C = 50% – 31% = 19%

Question 19. What is an origin of replication in a chromosome? State its function. (Delhi 2019) Answer: Replication does not initiate randomly at any place in DNA (chromosome). So, there is a definite region in DNA (chromosome) termed as origin of replication. It is the place from where DNA replication originates. It helps in propagation of a piece of DNA, during recombinant DNA procedures.

Question 20. Although a prokaryotic cell has no defined nucleus, yet DNA is not scattered throughout the cell. Explain. (2018) Answer: Prokaryotes lack a defined nucleus. However, the DNA is not scattered throughout the cell. This is due to the fact that the negatively charged DNA is held with some positively charged proteins in nucleoid or the middle region. In this region, the DNA is organised in large loops held by proteins.

Question 22. Discuss the role enzyme DNA ligase plays during DNA replication. (All India 2016) Answer: DNA ligase facilitates the joining of Okazaki fragments in lagging DNA strands together by catalysing the formation Of phosphodiester bond. It also plays a role in repairing single-strand breaks in duplex DNA.

Question 23. In a typical nucleus, some regions of chromatin are stained light and others dark. Explain why is it so and what is its significance. (Outside Delhi 2016C) Answer: In a typical nucleus, some regions of chromatin are stained light because of loose packing of chromatin and some regions of chromatin are stained dark because, chromatin is densely packed. Euchromatin is transcriptionally active chromatin (lightly stained) while heterochromatin (darkly stained) is transcriptionally inactive.

Question 24. Explain the two factors responsible for conferring stability to double helix structure of DNA. (All India 2014) Answer: Two factors responsible for conferring stability to double helix structure of DNA are

• Stacking of one base pair over other.
• H-bonds between nitrogenous bases.

Question 25. State the difference between the structural genes in a transcription unit of prokaryotes and eukaryotes. (All India 2014) Answer: Prokaryotic structural genes are continuous and are without any non-coding region, while eukaryotic structural genes contain exons (coding DNA) and introns (non-coding DNA).

Question 27. A template strand is given below. Write down the corresponding coding strand and the mRNA strand that can be formed, along with their polarity. (Foreign; 2014) 3′- ATGCATGCATGCATGCA TGCATGC-5′ Answer: For the given template strand 3- ATGCATGCAT GCATGCATGCATGC- 5′ Coding strand is 5′- TACGTACGTACGTACGTACG TACG – 3′ and mRNA strand is 5′- UACGUACGUACGUACGU ACGUACG – 3′

Question 29. State the functions of the following in a prokaryote: (i) tRNA (ii) rRNA (All India 2012) Answer: (i) tRNA helps in transferring amino acids to ribosome for the synthesis of polypeptide chain. (ii) rRNA plays structural and catalytic role during translation.

Question 30. Differentiate between a cistron and an exon. (All India 2012C) Answer: Differences between cistron and exon are as follows

Question 31. Differentiate between exons and introns. (All India 2012C) Answer: Differences between exons and introns are as follows

Question 32. State the dual role of deoxyribonucleoside triphosphates during DNA replication. (Delhi 2011) Answer:

• The deoxyribonucleoside triphosphates are the building blocks for the DNA strand (polynucleotide chain), i.e. they act as substrates.
• These also serve as energy source in the form of ATP and GTP because of the presence of high energy terminal phosphate groups.

Question 35. Answer the following questions based on Meselson and Stahl’s experiment on E.coli. (i) Write the name of the chemical substance used as the only source of nitrogen in the experiment. (ii) Why did they allow the synthesis of the light and the heavy DNA molecules in the organism? (iii) How did they distinguish the heavy DNA molecules from the light DNA molecules? (iv) Write the conclusion the scientists arrived at, at the end of the experiment. (All India 2019,11) Answer: (i) NH 4 Cl (Ammonium chloride) with N 14 atom. (ii) It is to show that after one generation E. coli with 15 N -DNA in a medium of 14 N, has DNA of intermediate density between the light and heavy DNAs. It shows that of the two strands, only one strand is synthesised newly, using the 14 N-nitrogen source in the medium. (iii) The heavy and light DNA molecules can be differentiated by centrifugation in a cesium chloride (CsCl) density gradient. The 15 N -DNA was heavier than 14 N -DNA and the hybrid 15 N – 14 N -DNA was intermediate between the two newly form DNA strands. (iv) Scientists concluded that the DNA replication is semi-conservative, i.e. of the two strands of DNA, one is the parental strand, while the other is newly synthesised.

Question 36. Explain the mechanism of DNA replication with the help of a replication fork. What role does the enzyme DNA-ligase play in a replication fork? (Delhi 2019) Answer: Replication in DNA strand occurs within a small opening of the DNA helix, known as replication fork. For figure, see Answer No. 26. DNA polymerases catalyse polymerisation only in one direction, i.e. 5′ → 3′. It creates additional complications at the replicating fork. Consequently, on one strand (template 3′ → 5′), the replication is continuous. This is known as leading strand, while on the other strand (template 5′ → 3′), it is discontinuous. This is known as lagging strand. The discontinuously synthesised fragments called Okazaki fragments are later joined by DNA ligase.

Question 38. Why is DNA molecule considered as a better hereditary material than RNA molecule? (2018C) Or Why is DNA a bettter genetic material when compared to RNA? (Delhi 2015C) Or Why is DNA considered a better hereditary material than RNA? (Foreign 2012) Answer: DNA is considered a better genetic material when compared to RNA because of its high stability and low reactivity. RNA being more reactive, is labile and easily degradable. The high reactivity of RNA is contributed by the 2-OH group in the nucleotides. RNA as a catalyst (e.g. ribozyme) is also more reactive. Uracil present in RNA makes it unstable over DNA that contains thymine.

Question 39. Name the three polymerases found in eukaryotic’cells and mention their functions. (2018C) Answer: Three types of RNA polymerases are found in eukaryotic cells and their functions are as follows

• RNA polymerase-I transcribes rRNAs.
• RNA polymerase-II transcribes the precursor of mRNA called hnRNA.
• RNA polymerase-III transcribes tRNA, 5 SrRNA and swRNAs.

Question 40. Explain the post-transcriptional modifications the AnRNA undergoes in eukaryotic. (2018C) Answer: Refer to page no. 138-139.

Question 42. Describe the experiment that helped demonstrate the semi-conservative mode of DNA replication. (All India 2016) Or How was a heavy isotope of nitrogen used to provide experimental evidence to semi-conservative mode of DNA replication? (Foreign 2015) Answer: Matthew Meselson and Franklin Stahl conducted an experiment with Escherichia coli (1958) as follows

• They grew many generations of E. coli in a medium that contained 15 NH 4 Cl ( 15 N is the heavy isotope of nitrogen) as the only source of nitrogen. The result was that 15 N was incorporated into the newly synthesised DNA. Upon centrifugation in a cesium chloride (CsCl) density gradient, this heavy DNA molecule could be distinguished from the normal DNA.
• The cells were then transferred into a medium containing normal 14 NH 4 Cl.
• At definite time intervals, as the cells multiplied, samples were taken and the DNA which remained as double-stranded helices were extracted.
• The samples were separated independently on CsCl gradient to measure the densities of DNA.
• The DNA obtained from the culture, one generation after the transfer from 15 N to 14 N medium had a hybrid or intermediate density.

Thus, Meselson and Stahl concluded that the DNA replication is semi-conservative, i.e. out of the two strands of DNA one is the parental strand, while another is newly synthesised.

Question 43. (i) Differentiate between a template strand and coding strand of DNA. (ii) Name the source of energy for the replication of DNA. (Delhi 2015C) Answer: (i) Differences between template strand and coding strand are as follows

(ii) The source of energy for the replication of DNA are the deoxyribonucleoside triphosphates that have two terminal high energy phosphates.

Question 44. (i) A DNA segment has a total of 1000 nucleotides, out of which 240 of them are adenine containing nucleotides. How many pyrimidine bases this DNA segment possesses? (ii) Draw a diagrammatic sketch of a portion of DNA segment to support your answer. (Delhi 2015) Or (i) A DNA segment has a total of 1500 nucleotides, out of which 410 are guanine containing nucleotides. How many pyrimidine bases this segment possesses? (ii) Draw a diagrammatic sketch of a portion of DNA segment to support your answer. (All India 2015) Or (i) A DNA segment has a total of 2000 nucleotides, out of which 520 are adenine containing nucleotides. How many purine bases this DNA segment possesses? (ii) Draw a diagrammatic sketch of a portion of DNA segment to support your answer. (Delhi 2014) Answer: (i) According to Chargaff’s rule, ratio of purines to pyrimidines is equal, i.e. A + G = C + T The number of adenine (A) is equal to the number of thymine (T). A = 240(given) Therefore, T = 240 Also, the number of guanine (G) is equal to cytosine (C). Thus, G + C = 1000 – [A + T] G + C = 1000 – 480= 520 Hence, G = 260, C = 260 The number of pyrimidine bases, i.e. C + T= 240 + 260 = 500

(ii) Refer to above figure. Or (i) Given, A = 520 therefore, T = 520 A + T = 520 + 520 = 1040 Total number of nucleotides = 2000 G + C = 2000 – 1040 = 960 G = 960/2 = 450 Hence, total number of purine bases are ⇒ A + G = 520 + 480 = 1000 (ii) Refer to above figure.

Question 46. (i) What are the transcriptional products of RNA polymerase-III? (ii) Differentiate between capping and tailing. (iii) Expand ArcRNA. (All India 2014C) Answer: (i) RNA polymerase-III is responsible for the transcription of tRNA, SrRNA and snRNAs (small nuclear RNAs). (ii) In capping process, an unusual nucleotide (methyl guanosine triphosphate) is added to ‘5’ end of hnRNA. In tailing process, 200-300 adenylate residues are added at 3′ end of hnRNA. (iii) hnRNA is heterogeneous nuclear RNA.

Question 47. It is established that RNA is the first genetic material. Explain giving three reasons. (Delhi 2012) Answer: RNA is the first genetic material in cells because

• RNA is capable of both storing genetic information and catalysing chemical reactions.
• Essential life processes (such as metabolism, translation, splicing, etc.) were evolved around RNA.
• It shows the power of self-replication.

Question 49. List the salient features of double helix structure of DNA. (All India 2012) Answer: Salient features of DNA double helix are as follows

• It is made up of two polynucleotide chains containing the backbone of sugar-phosphate from which the bases project inside.
• The two chains have anti-parallel polarity, i.e. one of them is 5′ → 3′, the other has 3′ → 5’polarity.
• The bases in two strands are paired through hydrogen bond (H-bonds) forming base pairs (bp). Adenine pairs through two hydrogen bonds with thymine on opposite strand and vice-versa. In the same way, guanine is bonded with cytosine through three H-bonds. Due to which, purine always comes opposite to a pyrimidine.
• The two chains are coiled in a right-handed fashion. The pitch of the helix is 3.4 nm and there are roughly 10 bp in each turn. Consequently, the distance between base pair in a helix is about 0.34 nm.
• The plane of one base pair stacks over the other in double helix. This confers stability to the helical structure.

Question 50. How is hnRNA processed to form mRNA? (Foreign 2012) Answer: The precursor of mRNA transcribed by RNA polymerase-II is called heterogeneous nuclear RNA (hnRNA). It undergoes following processing to form nascent wRNA.

• Splicing In this process, the non-coding introns are removed and coding sequences called exons are joined in a definite order. This is required because primary transcript contains both introns and exons.
• Capping Refer to Answer No. 46.
• Tailing Refer to Answer No. 46.
• The fully processed mRNA is released from the nucleus into cytoplasm for translation.

Question 51. The base sequence in one of the strands of DNA is TAGCATGAT. (i) Give the base sequence of the complementary strand. (ii) How are these base pairs held together in a DNA molecule? (iii) Explain the base complementarity rule. Name the scientist who framed this rule. (Delhi 2011) Answer: (i) ATCGTACTA. (ii) Base pairs are held together by weak hydrogen bonds, adenine pairs with thymine by two H-bonds and guanine pairs with cytosine through three H-bonds. (iii) Base complementarity rule : For a double-stranded DNA, this rule states that the ratio between adenine and thymine and that between guanine and cytosine are constant and equal to one. Erwin Chargaff framed this rule.

On the template strand with 5′-» 3’polarity, the new strand is synthesised from the point of replication fork in short stretches called Okazaki fragments and this strand is called lagging strand. Okazaki fragments are later joined by DNA ligases to form a continuous strand.

Question 53. Monocistronic structural genes in eukaryotes have interrupted coding sequences. Explain. How are they different in prokaryotes? (Delhi 2011C) Answer: Monocistronic structural genes in eukaryotes have interrupted coding sequences due to the presence of introns, i.e. non-coding sequences.

Differences between monocistronic structural gene in prokaryotes and in eukaryotes are as follows

Question 54. Explain the role of 35S and 32P in the experiments conducted by Hershey and Chase. (All India 2010C) Answer: Hershey and Chase used 35 S and 32 P in their culture medium. These are radioactive sulphur and phosphorus, respectively. These two components were used to detect whether the genetic material is DNA or protein.

Role of 32 P and 35 S Viruses grown on medium with 32 S. had non-radioactive genetic material and radioactive protein as sulphur is not present in DNA but found in protein. While those grown on 32 P had radioactive genetic material because DNA contains phosphorus but proteins does not contain it. Thus, it was established that DNA is the genetic material.

Question 59. Describe the role of RNA polymerases in transcription in bacteria and in eukaryotes. (Foreign 2010) Answer: In bacteria, there is a single DNA-dependent RNA polymerase, which catalyses the formation of mRNA, tRNA and rRNA. In eukaryotes, there are three types of RNA polymerases, which show division of labour. These are as follows

• RNA polymerase-I transcribes rRNAs, (28S, 18S and 5.8S)
• RNA polymerase-III transcribes tRNA, 5 SrRNA and snRNAS.

(ii) Various experiments were conducted to prove that DNA is the genetic material. Griffith did his experiment and concluded that some substance causes transformation. However, he did not tell the substance that had caused the transformation.

Biochemical Characterisation of Transforming Principle Three scientists Avery, MacLeod and McCarty revealed that the chemical nature of the transforming substance was DNA. They showed that DNA isolated from S-strain could itself confer the pathogenic properties to R-strain.

Thus, on the basis of their experiment, they concluded that DNA is the hereditary material.

Question 61. (i) Why does DNA replication occur in small replication forks and not in its entire length? (ii) Why is DNA replication continuous and discontinuous in a replication fork? (iii) State the importance of origin of replication in a replication fork. (2018C) Answer: (i) DNA replication occurs in small replication fork and not in its entire length because whole DNA cannot be opened in one stretch due to high energy requirement.

(ii) DNA replication is continuous and discontinuous in a replication fork because the enzyme DNA polymerase can carry out polymerisation of the nucleotides only in 5-3′ direction. On the template strand with 3-5′ polarity, DNA replication is continuous. On the template strand with polarity 5′-3′, the DNA replication occurs in short stretches and is called discontinuous.

(iii) Replication of DNA does not initiate randomly, and DNA polymerases on their own cannot initiate replication. So, there is a need of specific sequence, called origin of replication from which the replication starts. DNA polymerase binds to it and continues the process.

Bacteria which were infected with viruses that had radioactive DNA were radioactive, indicating that DNA was the material that passed from the virus to the bacteria. Bacteria that were infected with viruses that had radioactive proteins were not radioactive. This indicated that the proteins did not enter the bacteria from viruses. It proved that DNA is the genetic material that is passed from virus to bacteria.

Question 63. (i) Name the stage in the cell cycle where DNA replication occurs. (ii) Explain the mechanism of DNA replication. Highlight the role of enzymes in the process. (iii) Why is DNA replication said to be semi-conservative? (All India 2016) Or (i) Explain the process of DNA replication with the help of a schematic diagram. (ii) In which phase of the cell cycle does replication occur in eukaryotes? What would happen if cell division is not followed after DNA replication? (Delhi 2014) Or (i) Draw a labelled diagram of a ‘replicating fork’ showing the polarity. Why does DNA replication occur within such ‘forks’? (ii) Name two enzymes involved in the process of DNA replication, along with their properties. (Outside Delhi 2015) Answer: (i) During the synthetic phase of interphase of cell cycle DNA duplicates or replicates. (ii) Process of DNA Replication Replication is an energy expensive process, deoxyribonucleoside triphosphate serves the dual purpose of

In a long DNA molecule, replication takes place within a small opening of the DNA helix, known as replication fork because whole DNA does not open in one stretch due to high energy requirement. DNA dependent DNA polymerases catalyse polymerisation only in one direction, i.e. 5′ → 3′. This brings additional complications at the replication fork.

Enzymes for DNA Replication The process of replication requires a set of catalysts (enzymes) as given below (a) DNA-Dependent DNA Polymerase: It is the main enzyme which uses a DNA template to catalyse the polymerisation of deoxynucleotides. The average rate of polymerisation is 2000 bp (base pairs) per second approximately. These enzymes are highly efficient as they have to catalyse polymerisation of a large number of nucleotides in a very short time. These polymerases act very fast, catalyse the replication process with high degree of accuracy as any mistake would result in mutations.

(b) Helicase It unwinds the DNA strand, i.e. separates the two strands from one point for the formation of a replication fork.

(c) DNA Ligase It facilitates the joining of DNA strands together by catalysing the formation of phosphodiester bond. It plays a role in repairing single strand breaks in duplex DNA.

(iii) It is said to be semi-conservative because in newly synthesised DNA, one strand is parental and one is new, so it conserves the one strand. DNA replication is followed by cell division. In case, the latter fails to occur, polyploidy may occur.

Question 64. List the criteria of a molecule that can act as genetic material must fulfil. Which one of the criteria is best fulfilled by DNA or by RNA thus making one of them a better genetic material than the other? Explain. (All India 2016) Answer: From the Hershey and Chase experiment, the fact was established that DNA acts as genetic material. But later studies revealed that in some viruses (e.g. Tobacco Mosaic Viruses, QB bacteriophage, etc.) RNA is the genetic material. Following are the criteria that a molecule must fulfil to act as a genetic material.

• It- should be able to replicate.
• It should be chemically and structurally stable.
• It should provide the scope for slow changes (mutation), which are required for evolution.
• It should be able to express itself in the form of ‘Mendelian characters’.

According to these criteria, both DNA and RNA have the ability to direct their duplications (because of the rule of base pairing and complementarity).

So, both the nucleic acids (DNA and RNA) have the ability to direct their duplications, whereas the other molecules in the living system, fail to fulfil first criteria itself, e.g. protein. The most important criteria of genetic material is the stability as the genetic material should not change with the different stages of life cycle, age or with change in the physiology of an organism. Both DNA and RNA have the ability to mutate. Since, RNA is unstable, it mutates at a faster rate. That is why, those viruses, which have RNA genome and a shorter lifespan, undergo mutation and thus, evolve rapidly.

DNA is dependant on RNA for protein synthesis, whereas RNA directly codes for protein synthesis. This proves that both RNA and DNA act as genetic material, but DNA being more stable is preferred for the storage of genetic information.

Question 66. (i) How are the following formed and involved in DNA packaging in the nucleus of a cell? (a) Histone octamer (b) Nucleosome (c) Chromatin (ii) Differentiate between euchromatin and heterochromatin. (All India 2016) Answer: (i) (a) Histone Octamer Histones are the proteins that are rich in basic amino acids, i.e. lysine and arginine. Both these amino acids carry positive charges in their side chains. So, histones are a set of positively charged, basic proteins (histones + protamine). A histone octamer is formed by the organisation of two molecules each of H 2 A, H 2 B, H 3 and H 4 histones so asa to make a unit of 8 molecules. It helps to package DNA into nucleosome.

(b) Nucleosome The negatively charged DNA is wrapped around the positively charged histone octamer, forming a structure known as nucleosome. It forms the fundamental repeating units of eukaryotic chromatin. It is used to pack the large eukaryotic genome into the nucleus.

(c) Chromatin One nucleosome contains 200 base pairs of DNA helix, approximately. Nucleosomes are the repeating unit of chromatin, which are thread-like stained (coloured) bodies present in nucleus.

The nucleosomes in chromatin look like ‘beads-on-string’ when observed under an electron microscope. The chromatin is further packed to form a solenoid structure of 30 mm diameter and further supercoiling tends to form a looped structure called chromatin fibre and then chromatid. This further coils and condenses at metaphase stage to form the chromosomes.

(ii) Differences between euchromatin and heterochromatin are as follows

Question 67. (i) Explain with the help of Griffith’s experiment how the search for genetic material was conducted and what was the conclusion drawn? (ii) How did MacLeod, McCarty and Avery establish the biochemical nature of the so called ‘genetic material’ identified by Griffith in his experiment? (Delhi 2016C) Or (i) Describe the series of experiments of F Griffith. Comment on the significance of the results obtained, (ii) State the contribution of MacLeod, McCarty and Avery. (All India 2016, 2010) Or (i) Describe the experiment which demonstrated the existence of transforming principle. (ii) How was the biochemical nature of this transforming principle determined by Avery, MacLeod and McCarty? (Foreign 2015) Or (i) Describe the various steps of Griffith’s experiment that led to the conclusion of the ‘transforming principle’. (ii) How did the chemical nature of the ‘transforming principle’ get established? (All India 2014) Or (i) Write the conclusion drawn by Griffith at the end of his experiment with Streptococcus pneumoniae. (ii) How did O Avery, C MacLeod and M McCarty prove that DNA was the genetic material? Explain. (All India 2013) Or Describe Frederick Griffith’s experiment on Streptococcus pneumoniae. Discuss the conclusion he arrived at. (All India 2012) Answer: (i) Griffith Experiments: It took a long time to discover and prove that DNA acts as a genetic material. By 1926, the quest to determine the mechanism for genetic inheritance had reached the molecular level. Transforming Principle Frederick Griffith in 1928, carried out a series of experiments with Streptococcus pneumoniae (a bacterium that causes pneumonia).

He observed that when these bacteria (Streptococcus pneumoniae) were grown on a culture plate, some of them produced smooth, shiny colonies (S-type), whereas the others produced rough colonies (R-type).

This difference in appearance of colonies (smooth/rough) was due to the presence or absence of mucus (polysaccharide) coat. In his experiments, he first infected two separate groups of mice as follows S-strain (virulent strain) → Inject into mice → Mice die.

R-strain (non-virulent strain) → Inject into mice → Mice live. S-strain (heat-killed) → Inject into mice → Mice live. S-strain (heat-killed) + R-strain (live) → Inject into mice → Mice die.

Griffith concluded that the live R-strain, bacteria, had been transformed by the heat-killed S-strain bacteria. He concluded that, there was some ‘transforming agent that was transferred from the heat-killed S-strain, which helped the R-strain bacteria to synthesise a smooth polysaccharide coat and thus, become virulent.

He concluded that must be due to the transfer of the genetic material. However, he was not able to define the biochemical nature of genetic material from his experiments.

(ii) Contributions of MacLeod, McCarty and Avery : These scientists worked to determine the chemical nature of transforming principle of Griffith’s experiments. They discovered that protein digesting enzymes (proteases) and RNA-digesting.enzymes (RNase) did not affect transformation. Digestion with DNase did inhibit transformation suggesting that DNA was responsible for the transformation.

Question 68. (i) Describe the process of trancription in bacteria. (ii) Explain the processing the /mRNA needs to undergo before becoming functional mRNA in eukaryotes. (Outside Delhi 2016) Or Describe the process of transcription in bacterium. (All India 2014C) Answer: (i) The process of transcription in prokaryotes consists of three steps

• Initiation Refer to Answer No. 55.
• Elongation Refer to Answer No. 56.
• Termination Refer to Answer No. 57.

(ii) In eukaryotes, the primary transcript is often larger than the functional RNA, called heterogeneous nuclear RNA or hnRNA. Post-transcription processing is necessary to convert primary transcript of different types of RNAs into functional RNAs.

The processing includes

• Cleavage Larger RNA precursors are cleaved to form smaller RNAs.
• Splicing Eukaryotic transcripts possess extra segments called introns which are non-functional. They do not appear in mature or processed RNA. The functional coding sequences are called exons. Splicing is the removal of introns and fusion of exons in a definite order to form functional RNAs.
• Terminal additions (capping and tailing) Capping includes addition of an unusual nucleotide to 5’ end of hrRNA. These unusual segments are CCA segment in tRNA and cap nucleotides at 5’end of mRNA. In tailing, poly-A segment (200-300 residues) are added at 3’end of mRNA. Cap is formed by the modification of GTP into 7-methyl guanosine or 7 mG.
• Nucleotide modifications They are most common in tRNA-methylation (i.e. methyl cytosine, methyl guanosine), deamination (e.g. inosine form adenine), dihydrouracil, pseudouracil, etc.

Question 69. Explain the process of transcription in prokaryotes. How is the process different in eukaryotes? (Outside Delhi 2015) Answer: In prokaryotes or bacterial cell, transcription occurs in three steps-initiation elongation and termination. For detail, Refer to text on pages 138-139.

Question 70. (i) Explain the role of DNA-dependent RNA polymerase in initiation, elongation and termination during transcription in bacterial cell. (ii) How is transcription a more complex process in eukaryotic cells? Explain. (Foreign 2011) Answer: (i) Role of DNA-dependent RNA polymerase

• RNA polymerase becomes associated transiently with initiation factor (σ) and binds to the promoter site on DNA and initiates transcription.
• It uses the nucleoside triphosphate as substrates and polymerises them in a template-dependent fashion following the base complementarity rule in the 5′ → 3′ direction.
• It also facilitates the opening of the DNA helix and continues the elongation process.
• When the polymerase falls off a terminator region on the DNA, the nascent RNA separates. This results in termination.

(ii) Reasons that transcription is more complex in eukaryotes are (a) The three types of RNA polymerases in the nucleus show division of labour.

• RNA polymerase-I transcribes rRNAs (28S, 18S and 5.8S).
• RNA polymerase-II transcribes the precursor of mRNA, called hnRNA.
• RNA polymerase-III transcribes tRNA, 5 SrRNA and snRNAse.

(b) hnRNA contains both coding sequences called exons and non-coding sequences called introns. So, it undergoes a process called splicing, in which the non-coding sequences (introns) are removed and the coding sequences (exons) are joined together in a defined order.

(c) In capping, unusual nucleotide, methyl guanosine triphosphate residues are added at the 5’end of the hnRNA.

(d) In tailing, 200-300 adenylate residues are added at the 3’ end of the hnRNA.

Question 71. (i) Mention the contributions of the following scientists: (a) Maurice Wilkins and Rosalind Franklin (b) Erwin Chargaff (ii) Draw a double-stranded dinucleotide chain with all the four nitrogen bases. Label the polarity and the components of the dinucleotide. (All India 2011C) Answer: (i) (a) Maurice Wilkins and Rosalind: Franklin They carried out X-ray diffraction studies on the structure of DNA molecule. (b) Erwin Chargaff He proposed the base complementarity rule, according to which \(\frac { [A+G] }{ [T+C] }\) = 1

(ii) Refer to Answer No. 28.

Question 72. Study the flowchart given below and answer the questions that follows I. S-strain → into mice → mice die II. R-strain → into mice → mice live III. Heat-killed S-strain + Live R-strain → into mice → A IV. Heat-killed S-strain + DNase + Live R-strain → into mice → B (i) Name the organism and differentiate between its two strains S and R, respectively. (ii) Write the result A and B obtained in step III and IV, respectively. (iii) Name the scientist who performed the.steps I, II and III. (iv) Write the specific conclusion drawn from the step IV. (All India 2010C) Answer: (i) The organism is bacterium Streptococcus pneumoniae. Differences between S-strain and R-strain are as follows

(ii) 1 A – Mice died. B – Mice lived.

(iii) Frederick Griffith performed these steps.

(iv) When DNase was added to the medium, the DNA of the heat-killed cells got denatured and was unable to carry transformation. This indicates that DNA was the transforming component.

Question 73. Name one amino acid, which is coded by only one codon. (2018C) Answer: Methionine.

Question 74. Give an example of a codon having dual function. (All India 2016) Answer: AUG is a codon with dual functions. It codes for the amino acid methionine (met) and also acts as an initiator codon of polypeptide synthesis during protein synthesis.

Question 75. Write the two specific codons that a translational unit of mRNA is flanked by one on either sides. (Outside Delhi 2015C) Answer: Two specific-codons that are flanked on either sides of mRNA in a translation unit are

• Start codon (AUG)
• Stop codon (UAG or UAA or UAA).

Question 76. How does a degenerate code differ from an unambiguous one? (Foreign 2015) Answer: When some amino acids are coded by more than one codon, the code is said to be degenerate. On the other hand, when one codon codes for only one amino acid, it is called unambiguous.

Question 77. How is repetitive/satellite DNA separated from bulk genomic DNA for various genetic experiments? (Delhi 2014) Answer: Satellite DNA is separated from bulk genomic DNA by density-gradient centrifugation technique.

Question 78. State which human chromosome has (i) the maximum number of genes and (ii) the one which has the least number of genes. (Foreign 2014,2011) Answer: (i) Chromosome 1 (2968 genes). (ii) Chromosome Y (231 genes).

Question 79. Which one of the two subunits of ribosome encounters an mRNA? (Delhi 2013c) Answer: Smaller subunit.

Question 80. Differentiate between the following: Inducer and repressor in lac operon. (Delhi 2011C) Answer: Inducer It is a chemical which after coming in contact with repressor, changes it into non-DNA binding state, so as to free the operator gene. Repressor It is a regulator protein meant for blocking the operator gene.

Question 81. Mention the role of the codons AUG and UGA during protein synthesis. (Delhi 2011,10) Answer: AUG acts as initiation codon and codes for amino acid methionine. UGA acts as stop/termination codon that signals termination of polypeptide synthesis.

Question 82. Mention the contribution of genetic maps in human genome project. (All India 2011) Answer: Genetic maps are used as a starting point in the sequencing of whole genome.

Question 83. Mention any two ways in which Single Nucleotide Polymorphisms (SNPs) identified in human genome, can bring out revolutionary changes in biological and medical sciences. (All India 2011c) Answer:

• By tracing human history.
• By finding chromosomal locations for disease associated sequences.

Question 84. Differentiate between the genetic codes given below (i) Unambiguous and universal (ii) Degenerate and initiator (All india 2017) Answer: (i) The difference between unambiguous and universal genetic codes is as follows Unambiguous: In genetic code, one codon codes for only one amino acid, hence it is unambiguous.

Universal: The genetic code is universal, i.e. each codon codes for same amino acid in all organisms.

(ii) The difference between degenerate and initiator codes is as follows

Question 85. Following are the features of genetic codes. What does each one indicate? (All India 2016) Stop codon, Unambiguous codon, Degenerate codon, Universal codon. Answer:

• Stop codon does not code for any amino acids, e.g. UGA.
• Unambiguous codon codes for only one . amino acid, e.g. CCG codes for proline.
• Degenerate codon Genetic code is described as degenerate when a single amino acid is coded by more than one codon, e.g. serine is coded by 6 codons.
• Universal codons codes for the same amino acid in all organisms (except in mitochondria and few protozoan).

Question 86. What is aminoacylation? State its significance. (All India 2016) Or Explain aminoacylation of tRNA. (All India 2014C) Answer: Aminoacylation or charging of tRNA is a process in which amino acids get activated in the presence of ATP and get linked to their cognate tRNA. Significance of aminoacylation The charged tRNA carries amino acids to the site of protein synthesis. If two charged tRNAs are brought close to each other, the formation of peptide bond is favoured energetically.

Question 87. State the functions of ribozyme and release factor in protein synthesis, respectively. (Outside Delhi 2015C) Answer: Ribozyme in bacteria is 23S rRNA, that acts as an enzyme for the formation of a peptide bond between two amino acids. Release factor binds to the stop condon (UAA) to terminate translation and release the complete polypeptide.

Question 88. How would lac operon operate in E. coli growing in a culture medium, where lactose is present as source of sugar? (All India 2014C) Answer: When lactose is present in a medium having E. coli, it will act as a substrate for enzyme 3-galactosidase and switches on the operon. Hence, it is also termed as an inducer. It inactivates repressor by binding to it and allows RNA polymerase access to the promoter.

Question 89. Where does peptide bond formation occur in a bacterial ribosome and how? (Foreign 2014) Answer: A peptide bond is formed between carboxyl group (-COOH) of amino acid at P-site and amino group (-NH) of amino acid at A-site. It is formed by the enzyme peptidyl transferase in a bacterial ribosome.

Question 90. (i) Name the scientist who suggested that the genetic code should he made of a combination of three nucleotides. (ii) Explain the basis on which he arrived at this conclusion. (Delhi 2014) Answer: (i) George Gamow suggested that the genetic code should be made of a combination of three nucleotides. (ii) George stated that a codon must be of three bases in order to code for 20 amino acids, since there are only four bases (i.e. 43 or 4 × 4 × 4 = 64) which code for 20 amino acids.

Question 91. Why is charging of tRNA necessary during translation process? (All India 2014C) Answer: Amino acids are activated in the presence of ATP and linked to their cognate tRNA. This is called charging of tRNA (aminoacylation). The process is required as the formation of peptide bond between the amino acids is favoured energetically, when they are brought together. Activation of amino acids by ATP provides the energy for the formation of peptide bond.

Question 92. One of the salient features of the genetic code is that it is nearly universal from bacteria to humans. Mention two exceptions to this rule. Why are some codes said to be degenerated? (Foreign 2014) Answer: Genetic code is nearly universal except in mitochondrial codons and in some protozoans. Some amino acids are coded by more than one codon, hence some codes are said to be degenerated.

Question 94. Write the full form of VNTR. How is VNTR different from Probe? (All India 2011) Answer: VNTR-Variable Number Tandem Repeat. Difference between VNTR and Probe is as follows VNTR: It is a class of satellite DNA, where a small sequence is arranged tandemly in many copy numbers.

Probe: It is a radiolabelled VNTR, used for hybridisation with DNA segments in question.

Question 95. (i) Differentiate between unambiguous and degenerate codons. (ii) Write two functions of the codon AUG. (All India 2010C) Answer: (i) Differences between unambiguous and degenerate codons are as follows

(ii) Refer to Answer No. 2.

Question 96. ‘A very small sample of tissue or even a drop of blood can help determine paternity’. Provide a scientific explanation to substantiate how it is possible. (All India 2019) Answer: DNA fingerprinting is the basis of paternity testing in case of disputes. This technique is used to distinguish between individual of same species by using their DNA sample. The DNA is isolated from the cells and further amplified to produce many copies by using polymerase chain reaction. This amplified DNA is further processed to detect the presence of similarities between the parent and child.

Because, the DNA from sample can be amplified to produce many copies in DNA fingerprinting, only a very small sample of tissue or even a drop of blood can help determine paternity.

Question 97. Expand ‘BAC’ and ‘YAC’ what are they and what is the purpose for which they are used? (All India 2019,13) Answer: BAC — Bacterial Artificial Chromosome YAC — Yeast Artificial Chromosome. ‘BAC’ and ‘YAC’ are used as vectors in cloning of DNA.

Question 98. (i) Expand VNTR and describe its role in DNA fingerprinting. (ii) List any two applications of DNA fingerprinting technique. (2018) Answer: (i) VNTR The expanded form of VNTR is Variable Number of Tandem Repeats. These are short nucleotide repeats in the DNA. These are highly specific for individuals. No two individuals have the same VNTR.

Role of VNTR in Fingerprinting VNTRs are used as probe markers in the identification of DNA of different individuals because no two individuals can have the same VNTRs (except in case of monozygotic twins).

(ii) Applications of DNA Fingerprinting:

• DNA fingerprinting can identify the real genetic mother, father and offspring.
• DNA fingerprinting is very useful in the detection of crime and legal pursuits.

Question 99. (i) List the two methodologies which were involved in human genome project. Mention how they were used. (ii) Expand YAG and mention what was it used for. (All India 2017) Answer: (i) Two major methodologies involved in HGP are as follows

• Expressed Sequence Tags (ESTs) This method focuses on identifying all the genes that are expressed as RNA.
• Sequence annotation This method involves the sequencing of whole set of genome (that contained all coding and non-coding sequence) and then assigning functions to the different regions in the sequence.

(ii) YAC stands for yeast artificial chromosome. These were used as vectors in which fragments of whole DNA of human were inserted and cloned.

Question 100. A number of passengers were severely burnt beyond recognition during a train accident. Name and describe a modern technique that can help handover the dead to their relatives. (Delhi 2017) Or Following the collision of two trains a large number of passengers are killed. A majority of them are beyond recognition. Authorities want to handover the dead to their relatives. Name a modern scientific method and write the procedure that would help in the identification of kinship. (Delhi 2015) Or Following a severe accident, many charred-disfigured bodies are recovered from the site making the identification of the dead very difficult. Name and explain the technique that would help the authorities to establish the identity of the dead to be able to handover the dead to their respective relatives. (All India 2014C) Or In a maternity clinic, for some reasons the authorities are not able to handover the two newborns to their respective real parents. Name and describe the technique that you would suggest to sort out the matter. (All India 2013) Answer: The technique that can help in the identification of victims is DNA fingerprinting which is used to distinguish between individuals of same species by using their DNA sample. The chemical structure of DNA is same in everyone (99.9%) except the order of base pairs, i.e. only 0.1% of DNA makes every individual unique. DNA fingerprinting exploits the highly variable tandem repeating sequences, i.e. VNTRs for profiling. These VNTRs are highly conserved among members of the same species.

Technique: This technique is carried out in following steps:

• DNA Isolation DNA is extracted from the cells in a high speed centrifuge.
• Amplification Many copies of the extracted DNA can be made by the use of polymerase chain reaction.
• Digestion of DNA by restriction endonucleases.
• Separation of DNA fragments by electrophoresis.
• Blotting Transfer of separated DNA fragments to synthetic membranes (like nylon or nitrocellulose).
• Hybridisation, with the help of a radio-labelled VNTR probe (small segments of DNA which help to detect the presence of a gene in a long DNA sequence). These probes target a specific nucleotide sequence that is complementary to them.
• Autoradiography Detection of hybridised DNA fragments by autoradiography.

The presence of similarities between the victims and their relatives determines their association on the basis of which dead bodies or newborns can be identified and handed over to their families.

Question 101. (i) What do ‘Y’ and ‘B’ stand for in ‘YAC’ and ‘BAG used in Human Genome . Project (HGP)? Mention their role in the project. (ii) Write the percentage of the total human genome that codes for proteins and the percentage of discovered genes whose functions are known as observed during HGP. (iii) Expand SNPs identified by scientists in HGP. (All India 2016) Answer: (i) Y stands for yeast in the word YAC (Yeast Artificial Chromosome) and B stands for bacteria in the word BAC (Bacterial Artificial Chromosome). These are used as vectors in cloning of DNA. (ii) Less than 2% of the total human genome codes for protein, functions of 50 % of discovered genes are not known. (iii) SNPs stands for single nucleotide polymorphisms.

Question 102. (i) How many codons code for amino acids and how many are unable to do so? (ii) Why are codes said to be (a) degenerate and (b) unambiguous? (Delhi 2016C) Or (i) How many codons code for amino acids and how many do not? (ii) Explain the following giving one example of each. (a) Unamhiguous and specific codon (b) Degeneration codon (c) Universal codon (d) Initiator codon (All India 2010C) Answer: (i) Out of 64 codons, 61 code for amino acids and rest 3 codons do not code for any amino acids. These function as stop codons. (ii) (a) Unambiguous and specific codon These code for only one amino acid, thus, making the genetic code unambiguous and specific, e.g. UUU. (b) Some amino acids are coded by more than one codon, so the code is degenerate, e.g. serine is coded by 6 codons. (c) Codon is nearly universal. Some exceptions to the rule are mitochondrial codon and in some protozoans, e.g. UUU. (d) Initiator codon AUG has dual function. It codes for methionine and also acts as initiator.

Question 103. Write any three goals of human genome project. (Outside Delhi 2016C) Answer: The following are the goals of the human genome project:

• Identify all the (approximately) 20000-25000 genes in human DNA.
• Determine the sequence of the 8 billion chemical base pairs that make up human DNA.
• Improve tools for data analysis.

Question 104. What is mutation? Explain with the help of an example how does a point mutation affect the genetic code. Name another type of mutation. (Outside Delhi 2016C) Answer: A mutation is a sudden, stable, inheritable change in genetic material. A classical example of point mutation is a change of single base pair in the gene for p-globin chain that results in the change of amino acid residue glutamate to valine in a cell of a person suffering from sickle-cell anaemia. It is a genetic disease.

The other type of mutation includes frameshift insertion or deletion mutation. The insertion or deletion of one or more bases may change the reading frame from the point of insertion or deletion. Insertion or deletion of three or its multiple bases insert or delete one or multiple codon, hence one or multiple amino acid may be formed in polypeptide.

Question 105. Explain the significance of satellite DNA in DNA fingerprinting technique. (All India 2018) Answer: Significance of satellite DNA in DNA fingerprinting A DNA satellite is a region that consists of short DNA sequences repeated many times. The variation between individuals in the lengths of their DNA satellites forms the basis of DNA fingerprinting.

DNA satellites are of two types, i.e. microsatellites and minisatellites. Their characteristic that makes them useful for identification is that they are highly polymorphic. The length of each satellite in DNA is inherited.

The length of satellite regions is highly variable between people. These form small peaks during density gradient centrifugation and thus, are invaluable for identification purposes.

Question 106. Describe how the lac operon operates, both in the presence and the absence of an inducer in E. coli. (All India 2014) Answer: Lac operon is made up of one regulatory gene i and three structural genes (z, y, a). Its function in the presence and the absence of inducer is as follows (i) When inducer (lactose) is absent, i gene regulates and produces repressor mRNA. The repressor protein binds to the operator region of operon and as a result prevents RNA polymerase to bind to the operon. The operon is switched off in this situation.

(ii) When inducer (lactose) is present, lactose acts as an inducer and binds to the repressor. Thus, forming an inactive repressor. The repressor fails to bind the operator region. The RNA polymerase binds to the operator and transcripts lac mRNA.

Lac mRNA is known to be polycistronic which produces all three enzymes, i.e. P-galactosidase, permease and transacetylase required for the hydrolysis of lact >se. Operon is switched on in this situation.

Question 107. (i) What is a genetic code? (ii) Explain the following Degenerate code, Unambiguous code, Universal code, Initiator code. (All India 2014C) Or State the conditions when genetic code is said to be (i) degenerate (ii) unambiguous and specific (iii) universal (Foreign 2012) Or Unambiguous, universal and degenerate are some of the terms used for the genetic code. Explain the salient features of each of them. All India 2011 Answer: (i) Genetic code is the sequence of three nucleotides present on tnRNA which codes for a specific amino acid. (ii) Refer to Answer No. 30 (ii).

Question 108. Explain the process of translation. (All India 2014C) Answer: Translation is the process of polymerisation of amino acids to form a polypeptide with the help of mRNA, tRNA and ribosomes and many enzymes involved in the process. The different phases of translation are:

• Activation of amino acids (Refer to text on page no. 157).
• Initiation of polypeptide synthesis (Refer to text on page no. 158).
• Elongation of polypeptide chain (Refer to text on page no. 158).
• Termi’nation of polypeptide synthesis (Refer to text on page no. 158).

Question 109. (i) Which human chromosome has (a) maximum number of genes and (b) which one has fewest genes? (ii) Write the scientific importance of single nucleotide polymorphism identified in human genome. (All India 2014C) Answer: (i) Refer to Answer No. 6. (ii) Scientists have identified about 1.4 million locations, where single base DNA differences or Single Nucleotide Polymorphisms (SNPs) occur in humans. Since, these sequences have high degree of polymorphism they form the basis of DNA fingerprinting.

Question 111. (i) Explain DNA polymorphism as the basis of genetic mapping of human genome. (ii) State the role of VNTR in DNA fingerprinting. (All India 2013) Answer: (i) DNA polymorphism exhibited by certain repetitive DNA sequences is used to construct genetic and physical maps of the genome which are used in human genome project. (ii) Variable Number of Tandem Repeats (VNTRs) belong to a class of satellite DNA called as minisatellite. VNTRs are used as probes in DNA fingerprinting.

Question 112. Given below are the sequences of nucleoside in a particular mRNA and amino acids coded by it. UUUAU GUUC GAGUUAGU GUAA Phe – Met – Phe – Glu – Leu – Val Write the properties of genetic codes that can be and that cannot be correlated from the above given data. (Delhi 2013C, 2010C) Answer: UUUAUGUUCGAGUUAGUGUAA Phe – Met – Phe – Glu – Leu – Val According to the sequence given above

• Codon is triplet.
• Genetic code is specific and unambiguous. For example, AUG – Codes for methionine (Met) GAG – Codes for glutamine (Glu) UUA – Codes for leucine (Leu)
• Codon is degenerate, i.e. same amino acids are coded by more than one code. For example, UUU and UUC, both codes for phenylalanine (Phe).
• Code is read without punctuation.
• UAA acts as a terminating code.

Thus, all properties of codon are satisfied from the above given data. Except the one that mostly AUG work as an initiating codon.

Question 113. How are the structural genes activated in lac operon in E. coli ? (All India 2012) Answer: Lac operon consists of

• an operator, which controls all structural genes as a unit
• a regulatory gene (i gene)
• three structural genes (z, y, a), which code for enzymes and
• a promoter, where RNA polymerase binds for transcription.

Question 114. (i) Name the scientist who called tRNA an adapter molecule. (ii) Draw a clover leaf structure of tRNA showing the following (a) Tyrosine attached to its amino acid site. (b) Anticodon for this amino acid in its correct site (codon for tyrosine is UAC). (iii) What does the actual structure of tRNA look like? (All India 2011) Answer: (i) Francis Crick. (ii) Refer to Answer No. 38 (ii). (iii) The actual structure of tRNA looks like an inverted L.

Question 115. A considerable amount of lactose is added to the growth medium of E. coli. How is the lac operon switched on in the bacteria? Mention the state of the operon when lactose is digested. (All India 2010C) Answer: In lac operon, when lactose is added, it enters the cell wall with the help of permease, a small amount of which is already present in cell. Lactose binds itself to active repressor and changes its structure. The repressor now fails to bind to the operator.

Then, RNA polymerase starts transcription of operon by binding to promoter site-P. All the three enzymes for lactose metabolism are synthesised. After some time, when whole of lactose is consumed, there is no inducer present to bind to the repressor. Due to this, the repressor becomes active again, attaches itself to the operator and finally switches off the operon.

Question 119. (i) Write the contributions of the following scientists in deciphering the genetic code. George Gamow, Har Gobind Khorana, Marshall Nirenberg, Severo Ochoa. (ii) State the importance of genetic code in protein biosynthesis. (Delhi 2019) Answer: (i) George Gamow coined the term genetic code and argued that since there are only four bases and if they have to code for 20 amino acids, the code should constitute a contribution of bases. He suggested that in order to code for all* the amino acids the genetic code should be made up of 3 nucleotides.

Har Gobind Khorana developed a chemical 52 method for the synthesis of RNA molecule with defined base combinations (homopolymers and copolymers). Marshall Nirenberg Put forward a cell-free system for protein synthesis that helps in deciphering the code. Severo Ochoa Showed that the polynucleotide phosphorylase also helped in polymerising RNA with defined sequences in a template independent manner (enzymatic RNA synthesis).

(ii) The genetic code is the set of rules by which information encoded in genetic material is translated into proteins by living cells. The genetic code is nearly universal language that encodes directions for cells. Their arrangement as codons, stores the blueprint for amino acid chain. This chain in turn forms proteins which regulate the biological process in every living beings.

Question 120. What is an operon? Explain the functioning of operon when in an open state. (2018C) Answer: For operon and functioning of operon, Refer to text on page no. 159 and 160.

Question 121. (i) Explain the role of regulatory gene, operator, promoter and structural genes in lac operon when E. coli is growing in a culture medium with the source of energy as lactose. (ii) Mention what would happen if lactose is withdrawn from the culture medium. (Delhi 2016C) Answer: (i) For role of regulatory gene, operator gene, promoter gene and structural gene, Refer to text on page no. 159 and 160. (ii) If lactose is withdrawn from the culture medium, the repressor of the operon is synthesised from the i gene. This repressor protein binds to the operator region of operon and prevents RNA polymerase from transcribing the operon.

Question 122. (i) Write any two different levels at which regulation of gene expression could be exerted in eukaryotes. (ii) Give a labelled schematic representation of ‘lac operon’ in its switched off position. (All India 2016) Answer: (i) The different levels at which regulation of gene expression can be exerted in eukaryotes are following

• Transcriptional level (formation of primary transcript).
• Processing level (regulation of splicing)

(ii) Lac operon in switched off position Refer to Answer No. 21.

Question 123. (i) How is DNA fingerprinting done? Name any two types of human samples which can be used for DNA fingerprinting. Explain the process sequentially. (ii) Mention any two situations when the technique is useful. Outside Delhi 2016C Answer: (i) Refer to Answer No. 28. Samples that can be used for DNA fingerprinting are nails, blood, hair, skin, etc.

(ii) The technique is useful in the following situations

• Paternity testing in case of disputes.
• In determining population and genetic diversities.

Question 124. How do mRNA, tRNA and ribosomes help in the process of translation? (All India 2015) Or Name the major types of RNAs and explain their role in the process of protein synthesis in a prokaryote. (Foreign 2014) Answer: (i) Translation is the process of polymerisation of amino acids to form a polypeptide. The role of mRNA, tRNA and ribosomes in the process is described below (a) Role of mRNA The order and sequence of amino acids are defined by the sequence of bases in the mRNA. It stores the genetic information from DNA. The amino acids are joined by a bond, which is known as a peptide bond. This process requires energy mRNA also possesses untranslated sequences called Untranslated Regions (UTR) at both 5′ end and 3′ end. They help in efficient translation.

(b) Role of (RNA It acts as an adaptor molecule. Activation of amino acids occurs in the presence of ATP and activated amino acids get linked to their cognate tRNA, i.e. charging of fRNA or aminoacylation of tRNA.

If two such charged fRNAs are brought closer, the formation of peptide bond between them would occur energetically in the presence of a catalyst.

(c) Role of /RNA It is formed in nucleolus and it forms 80% of total RNA present inside the cell. It is also the most stable type of RNA. rRNA is associated with structural organisation of ribosomes (rRNA forms about 60% of weight of ribosomes), which are seats of protein synthesis.

(d) Role of ribosomes Initiation of polypeptide synthesis occurs in ribosomes (cellular factory for protein synthesis).

• Ribosome consists of structural RNAs and about 80 different proteins.
• In its inactive state, it exists as two subunits, i.e. a large and a small subunit.
• When the small subunit encounters an mRNA, the process of translation of the mRNA to protein begins.
• There are two sites in the large subunit, i.e. the P-site and A-site for subsequent amino acids to bind to and thus, be close enough to each other for the formation of a peptide bond.

Question 125. Sketch a schematic diagram of lac operon in switched on position. How is the operon switched off ? Explain. (Outside Delhi 2015C) Answer: (i) Refer to Answer No. 2.

Question 126. (i) Write the specific features of the genetic code AUG. (ii) Genetic codes can be universal and degenerate. Write about them, giving one example of each. (iii) Explain aminoacylation of the tRNA. (All India 2013) Answer: (i) Refer to Answer No. 2. (ii) Refer to Answer No. 30 (ii). (iii) Refer to Answer No. 14.

Question 128. (i) DNA polymorphism is the basis of DNA fingerprinting technique. Explain. (ii) Mention the causes of DNA polymorphism. (Foreign 2010) Answer: (i) DNA polymorphism It is the occurrence of inheritable mutations at a frequency greater than 0.01 in a population.

• Such variations often occur in non-coding sequences. They keep on accumulating generation after generation.
• Types of polymorphism range from single nucleotide change to very large scale changes.
• Single nucleotide polymorphism is used to diagnose disease related sequences of DNA on the chromosome.
• Variable number of tandem repeats show a high degree of polymorphism.

(ii) DNA polymorphism occurs due to mutations. Refer to text on page no. 161-162, for further detail.

Question 129. Name and describe the technique that will help in solving a case of paternity dispute over the custody of a child by two different families. (All India 2010) Answer: Refer to Answer No. 28.

Question 130. (i) Name the enzyme responsible for transcription of tRNA and the amino acid, the initiator tRNA gets linked with. (ii) Explain the role of initiator tRNA in initiation of protein synthesis. (Delhi 2012) Answer: (i) RNA polymerase transcribes tRNA and the amino acid, the initiator tRNA gets linked with is methionine. (ii) The initiator tRNA binds the amino acid methionine at its amino acid acceptor site. It has anticodon loop, which has anticodon for methionine, i.e. UAC. It recognises the start codon (AUG) at P-site and binds to it according to complementarity of bases.

Question 131. (i) Describe the process of aminoacylation. (ii) ‘Process of transcription and translation are coupled in prokaryotes, but not in eukaryotes’. Explain. (All India 2019) Answer: (i) Refer to Answer No. 14 on page no. 171. (ii) In bacteria, both processes occur in cytoplasm as there is no nucleus. In eukaryotes, transcription occurs in nucleus, while translation occurs in the cytoplasm.

Complexities in eukaryotic transcription: Eukaryotes have additional complexities in gene expression than prokaryotes as mentioned in gene expression below (a) There are at least three RNA polymerases in the nucleus other than the RNA polymerase in organelles. The RNA polymerase-I transcribes rRNAs (28S, 18S and 5.8S). RNA polymerase-III is responsible for the transcription of tRNA, 5srRNA and snRNAs (small nuclear RNAs). RNA polymerase-II transcribes precursor of mRNA, the heterogeneous nuclear RNA (hnRNA).

(b) Another complexity is that, the primary transcripts contain both the exons and the introns and are nonfunctional. Hence, it is subjected to a process called splicing. In this process, introns are removed and exons are joined in a definite order.

(c) hnRNA undergoes additional processing called capping and tailing. In capping, an unusual nucleotide is added to the 5′ end of ImRNA.

In tailing, adenylate residues (200-300) are added at 3′ end in a template. Capping and tailing protect the mRNA from degradation by the activity of digestive enzymes present in the cytoplasm. It is the fully processed hnRNA, now called mRNA, that is transported out of the nucleus for translation process.

Complexities in translation in eukaryotes

• The mRNA formed in nucleus has to be transported to the cytoplasm.
• Transcription and translation cannot be coupled in eukaryotes.

Question 132. (i) Describe the structure and function of a tRNA molecule. Why is it referred to as an adapter molecule? (ii) Explain the process of splicing of hnRNA in a eukaryotic cell. (All India 2017) Answer: (i) Structure of tRNA

• The secondary structure of tRNA looks like a clover-leaf.
• All tRNA molecules have a guanine residue at its 5’end.
• At its 3′ end an unpaired CCA sequence is present. Amino acids get attached to this end during translation.
• tRNA has an anticodon loop, an amino acid acceptor arm, and a ribosome site.
• The anticodon loop has bases complementary to the code. Amino acid acceptor end binds to amino acids.

(ii) Splicing of hnRNA Eukaryotic transcripts possess extra segments called introns or intervening sequences or non-coding sequences. They do not appear in mature or processed RNA. The functional coding sequences are called exons. Splicing is removal of introns and fusion of exons to form functional RNAs. A complex called spliceosome is formed between 5’end (GU) and 3’end (AG) of intron. Energy is obtained from ATP. It removes the introns. The adjacent exons are brought together. The ends are sealed by RNA ligase.

Question 133. Where do transcription and translation occur in bacteria and eukaryotes, respectively? Explain the complexities in transcription and translation in eukaryotes that are not seen in bacteria. (Foreign 2010) Answer: In bacteria, both processes occur in cytoplasm as there is no nucleus. In eukaryotes, transcription occurs in nucleus, while translation occurs in the cytoplasm. Complexities in eukaryotic transcription Refer to Answer No. 2. (ii)

Complexities in translation in eukaryotes are

• The OTRNA formed in nucleus has to be transported to the cytoplasm.

Question 134. According to human genome project, about 99.9% nucleotide bases are exactly the same in all humans. Do you think the discrimination of people on the basis of colour, creed and religion is correct? Justify. Answer: No discrimination of people on these grounds is not correct because all people have same genetic material (i.e. DNA) and are similar in their makeup.

Free Resources

NCERT Solutions

Quick Resources

• Biology Important Questions
• Class 12 - Biology
• Chapter 6: Molecular Basis Inheritance

Important Questions for Class 12 Chapter 6: Molecular Basis of Inheritance

Genes are the basic unit of heredity. Most of the genes comprises strands of genetic material called DNA. DNA comprises all the hereditary information of an individual. This information is passed on from one generation to the other in the form of homologous chromosomes. The DNA is transcribed into mRNA and translated into proteins. This is known as central dogma.

Explore important questions on the Molecular Basis of Inheritance for a better understanding of the concept.

Very Short Answer Type Questions

Q.1. State the function of histones in DNA packaging .

• They play a role in gene regulation.
• They help the DNA to wind around it.
• The histones are positively charged proteins, which can easily bind to the negatively charged DNA.

Also Read   DNA packaging .

Q.2. What is the difference between heterochromatin and euchromatin ?

Heterochromatin is a tightly packed DNA, which can be identified when stained in an extreme nuclear stain.

Euchromatin is a lightly packed DNA, which can be identified when stained in a less nuclear stain.

More Details:   Difference between heterochromatin and euchromatin

Q.3. Name any three viruses with RNA as the genetic material.

A.3. The viruses in which the genetic material is RNA is called the RNA virus. The three examples of the RNA virus.

• Influenza Virus.
• Hepatitis C Virus.
• Human Immunodeficiency Virus.

Explore More: Virus

Q.4. Give a reason for the discontinuous synthesis of DNA on one of the parental strands?

A.4. The biological process of DNA synthesis naturally occurs in 5′ to 3′ direction. In the double-stranded DNA, the strands are parallel and antiparallel to each other. During the synthesis of DNA, both the strands act as templates and only one (3′ to 5′ direction) can synthesize the parallel strand in 5’→3′ direction. The other strand 5′ to 3′ is synthesized in the opposite direction producing small stretches of DNA known as Okazaki fragments. This is the reason for the discontinuous synthesis of DNA on one of the parental strands.

Q.5. The sequence of the coding strand of DNA in a transcription unit is mentioned below.

3′ AATGCAGCTATTAGG 5′

Write the sequence for:

• Its complementary strand
• The complementary strand is  5′ TTACGTCGATAATCC 3′
• The mRNA is  5′ AAU GCAGCUAUUAGG 3′

Q.6. What is DNA polymorphism?

A.6. DNA’s polymorphism is the variation in the DNA sequence arising due to mutation at non-coding sequences.

Q.7. Retroviruses do not follow central dogma.  Comment on this statement

A.7. Retroviruses do not follow central dogma, because, they possess RNA as genetic material instead of the DNA, which is later converted into DNA by the enzyme reverse transcriptase.

Explore more: Retroviruses

Q.8. Sometimes, the young ones born have an extremely different set of eyes or limbs. Give a relevant explanation for the abnormality.

A.8. This abnormality is caused by many factors, including alcohol abuse by the mother during her pregnancy, medicine side effects or reactions caused to the womb,  environmental factors, such as maternal exposure to the chemicals, radiations, virus, and it can also be due to the genes and non-coordination in the regulation of expression in the set of genes associated with the development of organs.

Q.9. Explain about the dual polymerase present in E.coli.

A.9. The DNA polymerase present in E.coli is a DNA dependent polymerase. This DNA polymerase helps in the:

• Replication process.
• Performs the 5′ to 3′ polymerase activity as well as 3′ to 5′ exonuclease activity.
• The DNA polymerase III also has the ability to proofread the wrong nucleotides and substitutes it with the correct one.

Q.10. What are the functions of the :

• Methylated guanosine cap
• Poly-A tail

Methylated guanosine cap plays a primary role in the attachment of the mRNA to the smaller sub-units of the ribosome during translation initiation.

The Poly-A tail functions by increasing the length of the mRNA and also provides longevity to the mRNA.

Q.11. Mention any two functions of AUG codon.

A.11. The AUG codon is also called the start codon. The two important functions of AUG codon include:

• It codes for methionine.
• It acts as an initiation codon for protein synthesis.

Q.12. What is the function of amino acyl t-RNA synthase?

A.12.  Amino acyl t-RNA synthase plays a major role in the biosynthesis of proteins by attaching an appropriate amino acid on to the tRNA molecules.

Long Answer Type Questions

Q.1. Enumerate the post-transcriptional modifications in a eukaryotic mRNA.

A.1. Transcription is the process of conversion of DNA to mRNA. The post-transcriptional modifications include:

• Capping at 5’-end
• Poly-A tail at 3’-end
• mRNA splicing

The 5′ cap protects the RNA from ribonuclease. The poly-A tail protects the mRNA from enzymatic degradation. The introns are spliced during mRNA splicing and the exons are joined together to form a continuous sequence that codes for a functional protein.

Refer more:   Transcription

Q.2. Explain the process of translation.

A.2. The translation is the process of protein synthesis in which the mRNA is used to synthesize proteins. The mRNA sequence is decoded to specify the amino acid of a polypeptide. The process of translation is carried out in the following steps:

• Initiation.
• Elongation.
• Termination.

Also Read :  Translation

Q.3. Explain the process of DNA fingerprinting .

A.3. DNA fingerprinting is a technique that is used to analyze the genetic makeup of living beings. It is widely used for DNA analysis in forensic tests and paternity tests to identify the biological parents of the child, and also to identify the criminal during forensic investigations.

Extended Reading: DNA fingerprinting

Q.4. What is an operon? Explain an inducible operon.

A.4. An operon is the functional unit of DNA that contains a cluster of genes controlled by a single promoter. It consists of the following components:

• The DNA fragment that transcribes the mRNA.
• Regulator gene that codes for a repressor protein.
• Inducer that prevents the repressor from binding to the operator.
• A promoter where the RNA polymerase binds and initiates the transcription.
• An operator that is a DNA sequence adjacent to the promoter where the repressor protein binds.

The lac operon of E.coli is an inducible operon.

Q.5. Explain the process of DNA replication .

A.5. DNA replication is a biological process of producing two identical strands of DNA from the original strand. The original strand is known as the parent strand and the new strands are known as the daughter strands. This is achieved by a number of enzymes such as DNA polymerase, helicase, primase, topoisomerase, and ligase.

Read More:  DNA replication

For more information on Molecular Basis Of Inheritance, the  important question on exam point of view and other related topics, visit  BYJU’S Biology .

Other interesting topics

• Class 12 Biology Sample papers  
• Important Questions for Class 11 Biology
• Important Questions for Class 12 Biology
• Class 12 Biology Previous Year Question Papers

Leave a Comment Cancel reply

Your Mobile number and Email id will not be published. Required fields are marked *

Request OTP on Voice Call

Post My Comment

Great questions thanks for helping me in preparing my test

Good questions it helped me thank you

I need help from u for my studies.

Nice questions it helped me a lot for my studies

Good question it helped me thank you

Register with BYJU'S & Download Free PDFs

Register with byju's & watch live videos.

• Form 1 Mathematics Notes
• Form 2 Mathematics Notes
• Form 3 Mathematics Notes
• Form 4 Mathematics Notes
• Form 1 Mathematics Topical Questions and Answers
• Form 2 Mathematics Topical Questions and Answers
• Form 3 Mathematics Topical Questions and Answers
• Form 4 Mathematics Topical Questions and Answers
• Form 1 Functional Writing Notes
• Form 2 Functional Writing Notes
• Form 3 Functional Writing Notes
• Form 4 Functional Writing Notes
• Poetry Notes
• Grammar Notes
• Oral Literature Notes
• Oral Skills Notes
• Guide to Blossoms of the Savannah Summarized Notes - Easy Elimu
• A Doll's House
• The Pearl Study Guide
• Memories We Lost and Other Stories Study Guide
• Inheritance Study Guide
• A Silent song and Other Stories Guide
• Fathers of Nations Guide
• An Artist of the Floating World Guide
• The Samaritan Guide
• Sarufi na Matumizi ya Lugha
• Isimu Jamii Notes
• Fasihi Notes
• Ushairi Notes
• Mwongozo wa Kuandika Insha
• Tumbo Lililoshiba na Hadithi Nyingine
• Mwongozo wa Kigogo
• Mwongozo wa Chozi La Heri - Chozi la Heri Notes PDF
• Mwongozo wa Bembea ya Maisha - Bembea ya Maisha Notes PDF
• Mwongozo wa Nguu za Jadi
• Mwongozo wa Mapambazuko ya Machweo na Hadithi Nyingine
• Biology Form 1 Notes
• Biology Form 2 Notes
• Biology Form 3 Notes
• Biology Form 4 Notes
• Biology Essays
• Form 1 Biology Topical Revision Questions and Answers
• Form 2 Biology Topical Revision Questions and Answers
• Form 3 Biology Topical Revision Questions and Answers
• Form 4 Biology Topical Revision Questions and Answers
• Form 1 Chemistry Notes
• Form 2 Chemistry Notes
• Form 3 Chemistry Notes
• Form 4 Chemistry Notes
• All Chemistry Practicals Notes for KCSE and MOCKS
• Form 1 Chemistry Topical Revision Questions and Answers
• Form 2 Chemistry Topical Revision Questions and Answers
• Form 3 Chemistry Topical Revision Questions and Answers
• Form 4 Chemistry Topical Revision Questions and Answers
• IRE Form 1 Notes
• IRE Form 2 Notes
• IRE Form 3 Notes
• IRE Form 4 Notes
• Physics Form 1 Notes
• Physics Form 2 Notes
• Physics Form 3 Notes
• Physics Form 4 Notes
• CRE Form 1 Notes
• CRE Form 2 Notes
• CRE Form 3 Notes
• CRE Form 4 Notes
• Geography Form 1 Notes
• Geography Form 2 Notes
• Geography Form 3 Notes
• Geography Form 4 Notes
• History Form 1 Notes
• History Form 2 Notes
• History Form 3 Notes
• History Form 4 Notes
• Business Studies Form 1 Notes
• Business Studies Form 2 Notes
• Business Studies Form 3 Notes
• Business Studies Form 4 Notes
• Home Science Form 2 Notes
• Home Science Form 3 Notes
• Home Science Form 4 Notes
• Home Science Form 1 Notes
• Agriculture Form 1 Notes
• Agriculture Form 2 Notes
• Agriculture Form 3 Notes
• Agriculture Form 4 Notes
• Agriculture KCSE 2019 Project
• Computer Studies Form 1 Notes
• Computer Studies Form 2 Notes
• Computer Studies Form 3 Notes
• Computer Studies Form 4 Notes
• KCSE 2017 Reports
• 2018 Pre-Mocks
• 2019 Pre-Mocks
• 2022 Pre Mocks
• 2021/2022 Pre-Mock Past Papers
• 2023 Pre Mocks
• 2017 Mock Past Papers
• 2019 Mock Past Papers
• 2020 Mock Past Papers
• Mock Exam Papers 2021/2022 - Easy Elimu
• Mock Exam 2022 Questions and Answers
• Alliance Boys High School
• Maranda High School
• Form 1 Past Papers
• Form 2 Past Papers
• Form 3 Past Papers
• Form 4 Past Papers
• 2019 KCSE Prediction Papers
• 2020 KCSE Prediction Papers
• 2021 KCSE Prediction Papers
• 2022 KCSE Prediction Questions and Answers - EasyElimu
• KCSE Prediction 2023
• 2020 Post Mock Past Papers
• 2021/2022 Post Mocks
• 2023 Post Mocks
• Play Group: Activities, Homework and Syllabus
• 2023 PP1 Exams
• 2023 PP2 Exams
• Grade 1 Notes
• 2023 Grade 1 Exams
• Grade 2 Notes
• 2023 Grade 2 Exams
• Grade 3 Notes
• 2023 Grade 3 Exams
• Grade 4 Notes
• 2023 Grade 4 Exams
• Grade 5 Notes
• 2023 Grade 5 Exams
• Grade 6 Notes
• KPSEA Exams
• 2023 Grade 6 Exams
• Class 6 : Notes, Revision Papers and Syllabus
• Class 7 : Notes, Revision Papers and Syllabus
• Class 8 Notes
• 2023 Class 8 Exams
• 2023 Kcpe Prediction
• Grade 7 Notes
• 2023 Grade 7 Exams
• Form 3 Term 3 End Term 2022
• Form 2 Term 3 End Term 2022
• Form 1 Term 3 End Term 2022

Trending (7 New)

• 2024 Pre Mock Exams
• Fathers of Nations PDF Notes and Quizzes
• Fathers of Nations Excerpts with Answers
• The Samaritan Essay Questions with Answers
• The Samaritan PDF Notes and Quizzes
• A Silent Song and Other Stories PDF Notes and Quizzes
• Parliament of Owls Guide PDF Notes and Quizzes
• An Artist of the Floating World PDF Notes and Quizzes

Plot Summary - Guide to the Inheritance Play by David Mulwa

« Previous Topic Characters and Characterisation - Guide to the Inheritance Play by David Mulwa

Next Topic » Inheritance by David Mulwa - KCSE Essay Questions with Answers

Summary: Leadership Inheritance

Scene one: kutula's commemoration ceremony, scene two: lacuna's business deals with the imperialists, scene three: resistance and rebellion, scene one: judah zen melo's death, scene two: martial law and lacuna's predicaments, scene one: plans to overthrow lacuna's government, scene two: lacuna's loss of power.

• The prologue opens in Governor Thorne Macay's mansion, which is  described as lavish and one that rents the air of power and authority.
• The Governor is seemingly angry at the natives' ineptitude and  incompetence and feels disempowered by the abolition of the whip as  the natives have now downed their tools.
• The Governor's attendant has kept Bishop Menninger, (brain of the  empire) Princess Sangoi, and King Kutula, who have come to see the  governor, waiting for an hour because the latter is on a tea-break, and  when asked why he keeps the guests for that long replies,. your orders  is: " Do not disturb his excellent tea-time and meditetioning hour..." (p.3 -4) .
• The natives have rioted against the white settlers, destroyed their  property, molested the women and children and have breached the  agreement and trust made earlier  “…a situation that could lead to a  long bloody  war... ! " (p.8).
• Bishop Menninger has documented advice for the Governor. He points  out in the document that natives would never change from their  confused simple nature and that they would never be like the  sophisticated and civilized whites but would only remain as copycats.
• He also points out to the governor that the imperialists would have to  continue to rule and lay basic rules for the natives since left on their  own; they would offer nothing of significance.
• King Kutula 's entry to the governor's mansion is ushered in by an  attendant who regards him with awe and reverence.
• He addresses the king as  "The son of the king…from the stars and the  heaven,"   (p.6)
• Governor Thorne Macay has never understood the 'infernal allegiance’  that natives have their leaders but Menninger is born from their  inability to reason and think. He sees them as common animals way  below the whites whom he terms as democratic and civilized.
• Governor thorne has summoned the king to register his  disappointment about king Kutula’s silence on the escalating violence  in his kingdom resulting from the nationwide upraising by the natives  against the white  leaders.
• King Kutula dismisses Thorne’s concerns by quoting an African  proverb to mock the Governor. He says  “ The chameleon told the hare:  make your step I make mine; it is good company… friend.” (pg 8)
• Thorne is offended and threatens to imprison the king for life before  Menninger reminds him that he is talking to the king. He asks Thorne  to ask direct questions and avoid the long winged proverbs and  proverbial drivels when the king begins to bombard the governor with  many more proverbs and sayings.
• Thorne is then shocked when Kutula admits his knowledge of the  countrywide uprising and his support of the violence against the  governor’s people despite their good will to bring civilization to the  natives. He says,  “… I cannot shut the voices of my father…”  (pg 10)
• The governor is shocked by the sudden change of attitude when Kutula  bluntly tells him that  “we do not want you here!”  (pg 10)
• Kutula regrets why his fathers assented to the imperialist drafted  agreement that had allowed the colonialist to subject his people to  devastating effects of their oppressive rules and excessive zeal.
• Kutula threatens the governor that his people will continue to die if he  won’t let the natives build and run their home. He, however, has no  objection to the white man teaching the natives his was but with  moderation.
• Sangoi joins the leader and expresses her willingness to go abroad and  pursue the white man's education.
• Governor Thorne's fear over King Kutula's efforts to groom his adopted  daughter is that she will be an empowered matriarch and a lioness to  contend with in the future.
• Menninger is quick to console Thorne that Sangoi's education would  only confuse her. The Bishop's plan is to unleash Sangoi against her  simple folk upon the completion of her education for their benefit.
• What does Thorne mean by the statement,  "Africa supports, nay    maintains, the empire" (pg.4) ?
• "Make her a slave...again...Revisit history, Menninger...  revisit..." (pg.5) . What is your understanding of this  statement?
• In what ways do the natives exhibit  'infernal allegiance'  to  their leaders?
• Identify the proverbs in the prologue and their relevance.
• Menninger admits to use of  "excessive zeal."  How have the  natives reacted to it?
• "The king is dangerous. Like the Queen bee..."  Demonstrate  the truth of this statement.
• Comment on the conflict that arises in the prologue.
• What does Thorne mean when he says  "Turmoil in Africa  means a great loss to the empire"  (pg. 4)?
• Outline the reasons King Kutula gives for wanting the  imperialists to leave Kutula.
• Point out at instances in the prologue that reveal  Thorne Macay's attitude towards the natives.
• What is the prologue all about?

Movement One

• Kutula, thirty years later, is an independent Republic under the  leadership of Lacuna Kasoo yet the standards of living are poor.
• Tamina Zen Melo is emaciated and older than her age with no  proper housing and food.
• Bengo, a political activist who has just arrived from jail in the  capital, is treated to a cold welcome by Tamina who still holds to  age-old bitterness.
• Tamina explains to Bengo that the water they used to get from  the nearby springs and brooks has been diverted by Councilor  Chipande to Bukelenge Mountains fifteen kilometers away to  make a dam despite Reverend Sangoi 's protests. In fact, an  inauguration for the dam is done and receives much praise.
• The natives have been denied licenses to grow coffee and their  lands taken by Chipande after the Whiteman left making them  slaves in their own farms. Tamina says "My coffee farm in  Bukelenge Mountains? All gone. Now I must pick coffee for  Chipande on the farm that he had me sell to him for peanuts. "(p. 24).
• Tamina is bitter with Bengo because of his indulgence in  opposition politics that led to the near death of her husband,  Judah Zen Melo, who was Lacuna's spokesperson and party man,  after his refusal to kill his brother who was "Lacuna's thorn in his  political side."(p.23).
• This earns Judah unemployment and he is exiled. Tamina lost  everything including the good life she once lived.
• Bengo, who is popular and would have won the elections with a  landslide, is taken to jail to pave way for Chipande, Lacuna 's  crony.
• Lulu arrives home from school earlier than usual to collect the  two thousand shilling fees balance for the construction of a  perimeter fence and the computer laboratory despite paying one  thousand the previous day.
• Tamina complains of her lack of basics like food and water and  wonders about the essence of education. Lulu is bitter and  somewhat insolent and disrespectful to her mother.
• Lulu is frustrated by her mother's helplessness and poverty and  threatens her, "l will use my beauty then! I must complete school  and be somebody... in any way… (pg31 ) Unlike her mother Lulu  wants to be free from poverty and oppression.
• Judah arrives from the town of Patola and is warmly welcomed by  his wife. He says jobs were not forthcoming and the pay was low.  Besides, you needed your own tribesman to get a job.
• He sacrifices his morals for employment because, "... religion  doesn't sit well on an empty stomach..." (p.36). He therefore  begins drinking and bribes Mithambo with beer to get a job as a  Machine Operator. He works for long hours and competition is  stiff. Meanwhile, their sons are also in towns looking for jobs.
• Before Judah can rest, he leaves to "say hello to the crowd and  escort the sunset"(pg.38) but leaves Tamina eight hundred  shillings besides the assortment of groceries that he has brought  home.
• Lulu is back and apologetic for disrespecting her mother. She  learns of her father's return with excitement.
• Sangoi has been appointed a minister in the Ministry of  Reclamation and Remedies by Lacuna against her will. She  accepts the post for fear that Lacuna might assassinate her now  that during his coronation, people preferred Sangoi for Lacuna to  be their leader after King Kutula's death.
• The government plans to evacuate people from the valley and  Sangoi hopes that Lacuna would change his mind over the  evacuation before Kutula's much publicized commemoration  ceremony.
• Tamina is against Lulu's attendance of the king Kutula  commemoration ceremony, despite her key role as a lead dancer  in the school's dance troupe invited by Lacuna himself.
• It is only through Sangoi's intervention that Tamina permits Lulu  to attend what she calls "a pagan ritual"  (pg.43) on condition that  she would run back home after the festival. Sangoi promises to  watch over Lulu and even pay her school fees balance.
• Melo returns home drunk. He says he rules his family with love  and not machines and police guards like Lacuna. Judah  celebrates his family and refers to Tamina as "... beauty queen...  so beautiful..." and Lulu as "Girl, you're a black queen and... ori ...hic ...ginal!" (Pg.48 ) and challenges Lulu to work hard and  achieve her dreams of becoming a doctor and then he goes to  bed.
• Lulu is totally uninspired by her parents' marriage. She says, "If  this is what it means to be a parent, I won't follow their footsteps  to be crowned queen of rags". (pg.51 ).
• Outline the counter-productivity of Chipande's dam project.
• Why is Tamina still bitter with Bengo?
• In what ways is Bengo  "...a thorn in Lacuna's political side"?
• State the challenges that parents like Tamina with school-going  children must undergo.
• How does Judah Zen Melo's absence contribute to Tamina's  challenges?
• "I don't want this life! I don't! I don't!" (Pg.31 ) . What exactly does Lulu  mean by this statement?
• Describe how Zen Melo gets his job as a machine operator.
• What character of Lulu demonstrates her understanding of her goals in  life?
• Give three illustrations of incidences of disillusionment in this episode.

Movement Two

• The scene is set at Kutula Peoples' Park. The stage is set for  the celebration of a National Commemoration Day and all the  leaders, delegates, bosom friends of Kutula Republic and other  citizens are gathered at the park.
• Miss Gerima, the teacher is helping the dancers with the final  touches of rehearsals before the ritual begins.
• Lacuna steps forward to the royal grave to perform the  commemoration ritual.
• A pitcher with water is handed to Lulu who washes Lacuna's  hands. Lacuna then pours water at the foot of the grave and  then Lulu puts the crown on his head, gives him the mandate to  lead and declares the day to be a national rest day.
• Melissa comments that the crown does not fit Lacuna's head  and Sangoi is quick to say it's time Lacuna put the crown aside  as he doesn't fit the mandate.
• After the ceremony, Lacuna invites Sangoi and the school  children to a banquet in his palace. He is to discuss with  Sangoi matters of evacuation of the people, to pave way for the  irrigation project, although he is aware that she is against the  proposal.
• Lacuna then leads his guests in the banquet and is to later  share a meal with Lulu at his private chambers as required by  the custom.
• Describe the rituals performed during the commemoration  chronologically.
• What does Lacuna mean by "customs must bow to national  emergencies" (pg. 57)?
• Identify the irony of the quote in number 2 above.
• Comment on Sangoi's saying, "When the dead murmur in a conscience,  the guilty hear in it the terror of thunder, our forefather said it" (pg. 56).
• How do you think the national rest that Lacuna declares impacts on  the economy?
• Why do you think Sangoi, the elders and the two white men fail to  respond to Malipoa?
• Explain the symbolism in Lacuna's crown that does not fit and is lopsided on his head.
• Who is Gerima and what is her role in the commemoration ceremony?
• Describe Melissa's role in the episode.
• The setting shifts to the leader's palace formally, Governor
• Macay's residence which has now been extensively modernized. It  is here that Lacuna, Goldstein and Robert's meeting takes place.
• Chipande welcomes Goldstein and Robert to the palace. They are  catching up on the just ended commemoration ceremony before  Lacuna arrives.
• Chipande rudely handles the attendant. He brags about how he  treats them in summary statements in the name of democracy  and development while faulting King Kutula for having treated  everyone equally.
• Robert sarcastically points at how Africans love celebrations at  the expense of serious issues like time management and  economy. Chipande comes in defense saying. "the drums of  prayer and thanksgiving are intended to bring the dead and the  living to communion." (pg.59).
• Robert's contempt for Africans is evident when he says the whites  are superior and that "it's choking me . doing business with  immoral ragamumns..." (pg.60) . He adds that African leaders  borrow monies abroad in the name of the natives only to enrich  themselves- the money has availed nothing to the people.
• With reference to the extravagant and unnecessary banquet, he  notes that most drinks and meals served are imported. The  coffee is grown by the locals but then exported to London for  processing  then sold back to them. Robert wonders, "How can we  do business with people like these?" (pg.61 ).
• Goldstein's perspective of business is to lend, make profit and  enslave the natives by  "... putting the noose
• T he Whiteman and poisoned his own father to death. "He loved  me, but I killed him." (Pg. 69) . However, he goes ahead to justify  the murder, "... my father loved me but I loved my people  more...that's why he had to die." (Pg.69).
• Goldstein recounts what they have done for Lacuna and the  natives financed his inauguration.... Look, around thirty  universities with ultra-modern equipment computer. ...mining  Company
• Robert and Lacuna fall out because the former is quick to criticize  Lacuna's leadership.
• Planet World Financiers Limited had extended a loan of thirty  billion to salvage Kutula's economy. Lacuna gets arrogant when  Goldstein demands an account of how the money was spent  because he has no any record of expenditure. He threatens to  leave the office and to freeze Lacuna's accounts abroad.
• Lacuna tones down and admits to have embezzled the funds; he  bought himself a sleek aircraft and has banked thirty percent of  the money  in foreign accounts. He also discloses that he shares  the money with other leaders for their personal benefits.
• Lacuna cannot account for the rest of the money. Yet he claims to  be giving the natives free medical services, education, food, etc.
• Goldstein is now seated on the throne and takes advantage of an  intimidated Lacuna's ignorance, mismanagement of funds and  poor governance to set him into bigger loans.
• Lacuna now wants another bigger loan to boost the
• Economy and reclaim his popularity among the people yet has no  way of paying the loan back since the "...exports, silver, running at  a loss..." (pg.75) and fanning has dismal returns.
• To date, Kutula has a loan advancement of ninety eight billion  exclusive of interest and Lacuna and his ministers owe Robert  and Goldstein a hundred and twenty two billion which should be  paid within a month. However, the debt will be paid by Lacuna's  subjects.
• Lacuna is given conditions upon the new loan extended to him by  Goldstein.
• He is to ensure money is paid for jobs done and not offices  and positions and to avoid nepotism.
• He is also to remove controls on prices especially for the foreign  exchange.
• He should increase the production of silver and coffee for export.  Lacuna is also to cut down on employment and ensure longer  hours for workers.
• Concerning agriculture, he is to evacuate the occupants of the  valley to pave way for the irrigation project.
• State instances of sarcasm and discuss their significance.
• How effectively does the writer portray greed in this scene?
• Contrast the characters of Robert and Goldstein as portrayed in  the scene.
• Explain the motives of both Goldstein and Lacuna that lead to  King Kutula's assassination.
• "And we let you run it. Didn't interfere" (pg. 70) , Explain this  statement as made by Goldstein.
• Outline the conditions that Goldstein and Robert imposed on  Lacuna .
• Demonstrate in what way business between the West and Kutula  has "no human face". (pg. 82).
• "The mother befriended the weaver bird" (pg. 82) . What did  Lacuna's father mean by this statement?
• In your opinion, how does the Whiteman stand to benefit from the  conditions he imposes before advancing a loan to Lacuna?
• The scene is still in the palace. Sangoi and respected leaders  from Bukelenge Basin have come to see Lacuna over the  evacuation of people from the valley to Samuka.
• Lacuna wants the elders to convince the occupants of the  government's intention to relocate them and use the fertile basins  to reclaim agriculture as the Bukelenge valley is earmarked for  development
• Sangoi and the elders have put it plainly to Lacuna that the  evacuation will not be possible.
• Lacuna is annoyed by their disobedience and blames Sangoi for  poisoning the opinion leaders against the irrigation project. He  says, "... this silent rebellion... anything to do with you?" (Pg.85) .  Lacuna's contempt for his subjects is evident when he says the  mass is illiterate and they cannot think of international business.
• Lacuna threatens to eliminate Sangoi as he tells Chipande that  that is the only way for him to remain on the throne. He senses  strong opposition from Sangoi bearing Sangoi's popularity  amongst the people which he does not take for granted.
• Lulu is expected to spend a night with Lacuna in the Royal  chamber as the Annual Custom demands. All the preparations  have been done by Chipande. Apparently Lulu and Lacuna fail to  show up.
• Lacuna fears that his leadership will fail because Robert might  have defiled Lulu's purity before uniting Lacuna with the powerful  dead and the unborn of the world."She stands in the gap and  must usher in tomorrow's sun. She is the bridge." (pg.88).
• Lacuna tries to lure Lulu by his power and a luxuriant lifestyle  against that of Lulu that is poor. He tells her, "... what will your  mother give you? (Pg.93). But Lulu remains firm that she is too  young for him and still in school; besides, she respects Melissa.  She wonders why she has been confined in the palace and wants  to go home.
• The ritual is postponed until after four weeks and Lulu will be  confined in the chambers to be cleansed and taken care of so  that "...not to anger and pain and worry the wise ones within the  deep" (pg.92)
• Meanwhile, there is a peaceful demonstration outside by the  people from Malima Tema against the relocation of people  from the valley. Women, men and children are carrying twigs and  doves, singing, dancing and marching.
• Meshak, the commander of the armed forces, reports that the  demonstration is harmless and there is no need of using guns.
• Lacuna is annoyed to hear that no one has been shot or  imprisoned. He threatens that any leader who will not support the  evacuation will be dismissed forthwith and replaced by people  from the royal clan regardless of their level of education.
• State instances of superstition in Scene 3.
• In what ways does the Bukelenge Basin disappoint leader Lacuna?
• Contrast the reprisal of natives during King Kutula's reign to the  protest by the Bukelenge mountain occupants.
• "But let all be done in wisdom..." (pg. 92) . Show how Lacuna  takes [eave of wisdom in this scene.
• What character trait of Lacuna is revealed when he responds to Sangoi saying, "Their second alternative, begins, Sangoi And no,  go out there and effect obedience upon my people. Two weeks,  Sangoi " (pg. 86-87)
• What is Lacuna's perception of women in light of how he  describes Melissa on (pg. 94)?
• In what ways does Commander Meshack disappoint Lacuna with  regard to tracking the insurgents at Malima-Tema Mountains?
• What is your understanding of the word "cannibal" as used in the  scene?

Movement Three

• The scene is set in Tamina Zen Melo's hut. It is in the evening and  Tamina has just entered with a bundle of firewood.
• Judah has written a letter to inform her that he will be coming  home that day the second of September. In the letter, Judah  wants to know the whereabouts of his children.
• This reminds Tamina how Lulu, their daughter has been confined  in the palace with a promise of a new home and land in the  mountains which she detests. She says ,"...and he had the  prudence to salt my raw wound I spat on his face and he and his  friends fled from my cooking spoon." (pg.98).
• Sangoi visits Tamina's hut shortly. The issue of evacuation is a  grave one but all, including Tamina, will rally behind her. She  reports that she has not seen Lulu in the palace and that Judah  was visited in the mines concerning Lulu's marriage to Lacuna.
• Though hiding, Sangoi bears the bad news of Zen Melo's death.  Tamina says, "...my husband is dead, that's what you came to tell  me but you didn't have the courage. Is it true?" (Pg.100) . Judah  dies at the mines when the machine he operates snaps and  crushes him. Tamina is inconsolably desperate and breaks into  mourning.
• Bengo stops by Tamina's house and finds her beside herself with  grief and wants to assign some women to take care of her. The  Mother's Union in her church will look into her needs.
• Tamina is disillusioned and disappointed by Lacuna's leadership.  He has taken her husband, sons, Lulu her daughter and her valley.  She has nothing and no one to help her. Sangoi consoles Tamina.
• How does the discussion between Sangoi and Tamina at the  start of the scene prepare Sangoi to break the news of Judah's  death?
• Describe the events that lead to Judah Melo's death.
• Discuss the theme of hopelessness and disillusionment in the  scene,
• "The mole digs God's earth merely to live in... grass grows in the  soil he threw aside." Discuss the significance of this saying in the  scene.
• Which disease is Sangoi referring to by saying, "...this strange  disease from across the seas. The disease."
• Identify and explain an instance of biblical allusion from the scene.
• It is in the palace. Lacuna has a heated argument with Malipoa over  when he will have Lulu as a wife. Malipoa says another week will be  needed because Lulu is still mourning her father's death.
• Lacuna is disappointed by Lulu's consistent resistance to his  advances. He has poured libations to her late father's spirit; he has  channeled a lot of finances to her comfort in the palace and has  offered Tamina vast lands and labourers to till the land but she has  spurned his advances.
• Apparently, tea, coffee, silver show no promise, the  machines are broken down, and the industries are in  shambles besides assassinations of workers.
• The occupants of the valley still are due for evacuation
• Not a shilling of the one twenty billion borrowed is used  beyond the palace.
• Lacuna says the poor production is as a result of rotten machines  and the death of Judah who was the machine operator. However,  Robert tells him that they know Judah was murdered and not the old  machine's error as was reported.
• Goldstein holds the gadget screen to Lacuna to read, "Mene Mene  Tekel' (pg.109) , meaning he has been weighed and found wanting  and God has numbered his kingdom.
• When Lacuna bluntly states that he will pay the loan when he wants,  all his money in the private accounts abroad is transferred to pay the  debt. Robert says, "We must recover our debt." (pg.112).
• Lacuna has been disabled completely but orders the arrest of Robert  and Goldstein. He also declares a curfew from dawn to dusk.
• Lacuna orders Chipande to cancel the evacuation plans, suspend all  the workers ' salaries, and interdict all public officials including  councilors, ministers, directors and principals. Lacuna himself is to  be the commander in chief in place of Meshak.
• Lacuna has extended a hundred percent tax on the profits made by  all corporations, banks, parastatals and businesses and the money  to be collected into the national kitty under his custody.
• Chipande warns him of more riots now that the situation is volatile  because of the plans to forcefully evacuate the people from the  valley.
• Lacuna wants to be joined to Lulu in a holy matrimony before sunset.  Malipoa has gone to fetch her and before he comes back, Lulu  enters to meet Lacuna without permission from either the attendant  or Lacuna himself,
• Lacuna accuses Lulu of an affair with Robert. Lulu objects to the  accusation but then apologizes. She wants to go  home for the second interment of her late father and fears for her  name being tarnished as "a palace gold digger" (pg.119) besides, her  mother has disowned her.
• Lulu wants to pursue her academics and become a doctor. She  rejects Lacuna's advances of love and allure of pleasures. Lacuna is  infuriated and slaps Lulu.
• In annoyance, Lulu reminds Lacuna how he has kept her in the  palace against her will, killed her father, impoverished them and  made them slaves. Besides, he is ten times her father's age and will  never get married to him.
• Lulu is forcefully led out by Chipande and the guard and confined to  her quarters under Lacuna's command pending a forceful marriage.
• "All the wise ones have ordered, I have fulfilled." Outline all the  orders and how Lacuna has fulfilled them.
• "They must play the game-totally, if both parties are to benefit"  (pg. 107) . What does Robert mean by this?
• Why do you think Judah Melo is murdered in the mines?
• State the foreign banks that Lacuna has saved his money in.
• Cite instances of irony and sarcasm in the scene.
• "Did these hands embrace a foreigner?" (pg.118). What would be  the traditional implication of Lulu embracing a foreigner on the night  of the commemoration?
• Outline the weakness of Lacuna's leadership as portrayed in the  scene.
• Contrast the character of Lacuna as a leader and as a carnal man  with reference to the advances he makes on Lulu.

Movement Four

• It is at dawn in a house in the densely forested mountains. Bengo is  chairing a meeting of a group of leaders from the village both young  and old, which plans to overthrow Lacuna's government. Sangoi  comes in later.
• There is a conflict between the young male leader and the elderly  leader over the previous approach to issues where the elderly  leaders have been slow in the cause of their actions over serious  matters in the name of caution leading to the current predicament of  the people of Kutula.
• The group has to review their approach now that a curfew has been  declared to ensure the success of the demo. They have the support  of every tribe including some of Lacuna's loyalists.
• Bengo says that the mission should be accomplished without pain,  hate or bloodshed. He insists on unity to win and if not at least died  saying, " no" to tyranny; particularly the tyranny of our history and  international  neo- slavery." (pg.125).
• Sangoi is the favourite of everybody and the suggested leader after  Lacuna is overthrown. However, she accepts the leadership with a  condition to withdraw the armed section of the movement. This  receives a lot of objection from the leaders who feel they should be  armed because Lacuna has an armed army, too.
• Sangoi will embark on her church roles and a political leader sought  afterwards.
• How does the enemy catch Bengo and his family off-guard in the  entire play?
• "We have persisted because we know and are convinced that our  cause is just," Give reasons to justify this statement.
• Why do you think the people have so much confidence in Sangoi?
• What is the purpose of the meeting?
• Explain the conflict that arises between the young and the old.
• "Can you imagine the bitterness throughout the land?" Comment  on this statement with regard to the episode.
• Outline  the details of the plan on how to attack the palace.
• What does the young leader mean when he says, "Our leopards  move among Lacuna's forces" (pg. 124)?
• Outline the steps that the new leadership will take to rebuild the  state?
• Explain what Sangoi means by saying "They squandered it  and we have felt its yoke on our necks."
• It is in the morning and an agitated Lacuna and a cowering Chipande  are in the palace and out of control. Lacuna has fired everybody  including Malipoa.
• People have mobilized themselves and the demonstration is on.  Lacuna orders for the mobilization of the troops to attack the rabble  of dissidents and orders for the detention of Robert and Goldstein.
• Lacuna is obsessed with having Lulu as his second bride. He  instructs Chipande amidst the confusion to prepare to be the best  man during the ceremony.
• Lacuna is adamant until he hears the sounds of gunshots. Attendant  II shows him the march has drawn close to the palace from all  directions. The city is under attack, the barracks have fallen and the  palace has been besieged.
• The protestors surround the palace chanting, "Down with Lacuna!  Corrupting our children! Stealing from the poor! Starving the poor!" .  ..."We shall not be moved "Down with tyrants!" "Down with curfews  in free land!" (pg. 132).
• Meanwhile Bengo, Sangoi and Tamina come closer to Lacuna as  Bengo addresses the crowd about the need for justice and restrains  people from using violence against Lacuna.
• Reverend Sangoi addresses the crowd amid cheers and chants of  revenge to perpetrators of evil from the crowd. She confirms the  need to deal with the evils of the past before forging forward with  the reconstruction and healing of the land.
• Sangoi is quick to point out that the evil ones have reduced the  people to beggars in their own homeland, the youth into criminals  and drug addicts, disintegration of families ,"... Tamina, Zen Melo and  others . ...since disaster struck her home, she has lost her mind.. '' (pg.135).
• Lacuna is ordered to join Robert and Goldstein. The crowd refers to  them as leeches that bleed the country dry. Lacuna is guilty of  tyranny and sinking the country into debts.
• Sangoi commands Lacuna, Malipoa and Chipande to be jailed.
• Lacuna blames his advisors but Chipande says Lacuna always gave  orders.
• Even after Sangoi is educated abroad and married by a white, she  does not spare Goldstein and Robert. The two foreigners are  deported back to their country.
• She informs Robert in response to his demand for their debt that the  money was borrowed in the name of the natives but squandered by  Lacuna and his cronies.
• Lulu moves to the front where she embraces her mother Tamina.  Sangoi questions Lacuna over Lulu 's confinement and Tamina out  of rage slaps Lacuna for confining her daughter for many days.
• "I can see further without glasses than he with his spiritual  binoculars." Show the irony of Lacuna's statement in light of the  events later in the scene.
• What is Sangoi's role in liberating her people?
• "I AM POPULAR! Not so?" Comment on the irony of this  statement.
• Outline the evils that the natives have suffered due to Lacuna's  leadership.
• What is Bengo's role during the demonstrations?
• "Hang the leeches! Bleeding our country dry!" Explain the above  statements.
• Identify and explain the use of language in this episode.
• What is Sangoi's attitude towards Lacuna, Robert and Goldstein?

Download Plot Summary - Guide to the Inheritance Play by David Mulwa .

Why download.

• ✔ To read offline at any time.
• ✔ To Print at your convenience
• ✔ Share Easily with Friends / Students

Related items

• Inheritance by David Mulwa - KCSE Essay Questions with Answers
• Characters and Characterisation - Guide to the Inheritance Play by David Mulwa
• Language and Style (Stylistic Devices) - Guide to the Inheritance Play by David Mulwa
• Themes - Guide to the Inheritance Play by David Mulwa
• Setting and Title - Guide to the Inheritance Play by David Mulwa

access all the content at an affordable rate or Buy any individual paper or notes as a pdf via MPESA and get it sent to you via WhatsApp

What does our community say about us?

Join our community on:.

• KCSE Revision Questions
• Privacy Policy
• Mobile App Privacy Policy
• High Schools in Kenya
• Teacher Resources
• Questions and Answers
• Online Tuition and Classes in Kenya

Copyright © 2022 EasyElimu

The Inheritance of Loss

By kiran desai, the inheritance of loss essay questions.

How do Judge Patel's experiences at Cambridge influence his relationship with Nimi?

When Judge Patel first arrives in England, he is shocked by the nation's lack of grandeur and its "unaesthetic" poverty. Judge Patel mistakenly believed that by adopting British customs and celebrating British culture, he would be accepted into "civilized" society. Despite his advanced education, practiced manners, and commitment to assimilation, Jemu is rejected and scrutinized by strangers who refuse him accommodation and joke that he "stinks of curry." Ashamed of his accent and body, Jemu retreats into himself, studying tirelessly and washing obsessively until he feels "barely human at all." During his final examinations, Jemu's professors humiliate him. He is only accepted into the civil service to "Indianize" the program. Thus, Jemu starts to blame his Indian heritage for his failures and still desperately attempts to become British.

When Judge Patel returns to India, he feels like a foreigner; surrounded by Indian people and culture, he is constantly reminded of his shame and failure. Nimi epitomizes India for Jemu; though he "found beauty" in her face, he dismissed it, convincing himself English women were superior to Indian women. As Nimi refuses to change herself to accommodate Jemu, his abuse worsens.

How does Sai cope with isolation?

Sai grows up in a convent school in India while her parents work in Moscow. Under the nuns' tutelage, Sai is harshly disciplined and forced to conform to Western ideals; in this stressful environment, Sai makes few friends.

When Sai moves to Cho Oyu, she forms connections with others, though the mansion is remote. Sai encourages the cook's stories and spends most of her time with him; she regards the cook as a surrogate father. Sai also enjoys reading National Geographic magazines as well as travelogues, poring over photographs of distant places, which evoke deep and powerful emotions.

Sai also meets her need for human connection by pursuing an emotionally intense relationship with Gyan. Even when Gyan betrays and abandons Sai, her melancholy feelings comfort her.

How are Noni and Lola beneficiaries of colonial oppression? How are they victims of colonialism?

Noni and Lola are wealthy sisters who reside in a secluded mansion decorated with eclectic, multicultural objects. They enjoy a relatively easy life, as their wealth and social position allow them to employ servants and bodyguards and enjoy international entertainment, like books in multiple languages and radio access to the BBC. Lola and Noni's lifestyle is only possible because their parents' loyalty to the British crown afforded them a privileged position in India.

However, Lola and Noni's privileged lifestyle required them to follow strict social rules that prevent them from forming meaningful relationships. Lola and Noni's friendships are marred by jealousies and pettiness, and neither sister experienced genuine love. Noni's experiences in a colonial school destroyed her confidence, and she abandoned her dream of becoming an archaeologist.

How do Gyan and Judge Patel's journeys parallel one another?

Gyan and Judge Patel both come from families of modest means. Since both boys showed academic promise at a young age, their families invested time and resources into their education; they bore the pressure of elevating their family's status. Gyan and Judge Patel are both disillusioned when they reach age twenty; Judge Patel is traumatized at Cambridge University, and Gyan is passed over for jobs despite his college degree. Unwilling to process their disappointments and frustrations, Judge Patel and Gyan emotionally abuse and humiliate their romantic partners, who embody the forces they believe oppress them. For Judge Patel, Nimi embodies the "uncivilized" aspects of Indian culture, and for Gyan, Sai embodies the social privilege obtained by rejecting Indian culture.

How do Biju's experiences in America change his understanding of India?

Biju befriends people of various nationalities, cultures, and religions, like Saeed Saeed, a Zanzibarian Muslim. Other Indians, like Harish-Harry and the female students protesting gentrification, humiliate and condescend to Biju. Biju's friendships force him to reconsider racial prejudices readily accepted in his community and family. Through Biju's negative interactions with other Indian immigrants, he acknowledges that the Indian experience and the immigrant experience are diverse and nuanced. Biju struggles and suffers in New York City and begins to idealize his hometown, appreciating what he once took for granted. When Biju returns home, he does so with the understanding that, just like America is not the dreamland many Indians believe it to be, India is not the "backward" nation Americans believe it to be.

The Inheritance of Loss Questions and Answers

The Question and Answer section for The Inheritance of Loss is a great resource to ask questions, find answers, and discuss the novel.

Inheritance of Loss by Kiran Desai

GradeSaver has a complete list of characters, as well as their descriptions readily available in its study guide for the unit.

Summary of chapter 24

The food at the Ghandi cafe is the same generic Indian food that is served all throughout the states. Harish-Harry knows his market saying Indians make good immigrants because they understood demand-supply. Malini, Harish's wife is also a tough...

The climax of this novel want to know

The novel's climax occurs in Chapter 43, when the public burning of the Indo-Nepal Treaty devolves into violence between police and local residents.

Study Guide for The Inheritance of Loss

The Inheritance of Loss study guide contains a biography of Kiran Desai, literature essays, quiz questions, major themes, characters, and a full summary and analysis.

• About The Inheritance of Loss
• The Inheritance of Loss Summary
• Character List

Essays for The Inheritance of Loss

The Inheritance of Loss essays are academic essays for citation. These papers were written primarily by students and provide critical analysis of The Inheritance of Loss by Kiran Desai.

• The Inheritance of Loss: A Struggle with Cultural Identity
• Cultural Transcendence in The Inheritance of Loss and Clear Light of Day

Lesson Plan for The Inheritance of Loss

• About the Author
• Study Objectives
• Common Core Standards
• Introduction to The Inheritance of Loss
• Relationship to Other Books
• Bringing in Technology
• Notes to the Teacher
• Related Links
• The Inheritance of Loss Bibliography

Wikipedia Entries for The Inheritance of Loss

• Introduction

• International
• Education Jobs
• Schools directory
• Resources Education Jobs Schools directory News Search

Jekyll and Hyde: A* Grade / L9 Essay Example (Tension and Mystery)

Subject: English

Age range: 14-16

Resource type: Unit of work

Last updated

8 September 2024

• Share through email
• Share through twitter
• Share through linkedin
• Share through facebook
• Share through pinterest

This is a student essay that was written outside of timed conditions. It received an A* grade at GCSE, for the AQA English Literature syllabus. Typos and grammatical errors have been left in, to show that even a top grade is achievable with minor errors.

Have a resource on us! Grab our FREE resource here: Jekyll and Hyde: Character Breakdown / Analysis

Buy our COMPLETE JEKYLL AND HYDE REVISION BUNDLE here!

Please review us! We always value feedback and are looking for ways to improve our resources, so all reviews are more than welcome.

Check out our shop for more content!

Tes paid licence How can I reuse this?

Get this resource as part of a bundle and save up to 51%

A bundle is a package of resources grouped together to teach a particular topic, or a series of lessons, in one place.

A MEGA REVISION 'JEKYLL AND HYDE' BUNDLE! (Digital + Printable PDFs, PPTs and worksheets!)

This bundle contains everything you need to teach or study Stevenson's novella 'The Strange case of Dr Jekyll and Mr Hyde' in the form of digital and printable PDF documents. It’s perfect for students aged 14+. **This bundle is currently available at a 50% discount! ** Preview this document for free, to check whether the whole bundle is right for you [Jekyll and Hyde: Character Breakdown / Analysis](https://www.tes.com/teaching-resource/resource-13110830) With this bundle, students will be able to: * Understand the structural elements and key moments of the plot * Deepen their knowledge of characters, including understanding the deeper messages behind each one * Integrate the significance of the setting into their analyses and interpretations of the play as a whole * Memorise a range of carefully chosen key quotations for use in essays and analysis * Develop their language, structure and form analysis skills, with guided support and examples * Identify and analyse the thematic and contextual details * Learn approaches to a range of essay question types: discursive, argumentative, close reading * Become confident with extract interpretation and analysis * Develop their knowledge of tragic conventions and apply them to the novella * Expand their critical aptitude via exposure to key critical frameworks and critics’ quotations (for higher-level students) * Write their essays on Jekyll and Hyde, after support with planning help and example A* / top grade model answers Reasons to love this bundle: * Downloadable PDF documents, graphically designed to a high level, PowerPoints (ppts) and worksheets * Visual aids (photographs and drawings) to support learning * Organised categories that simplify the text for students * Print and digital versions - perfect for any learning environment * The unit has everything you need to start teaching or learning - starting with the basic story summary, going right up to deep contextual and critical wider readings * Lots of tasks and opportunities to practice literary analysis skills - students will be guided through writing a literary analysis response to the novella -This is what you’ll get with this bundle: (each document includes digital + printable revision guide + PowerPoint + worksheet)- THE COMPLETE JEKYLL AND HYDE COURSE: 1. [Character Analysis / Breakdown](https://www.tes.com/teaching-resource/resource-13110830) 2. [Plot Summary / Breakdown](https://www.tes.com/teaching-resource/resource-13110836) 3. [Context Analysis](https://www.tes.com/teaching-resource/resource-13110842) 4. [Genre](https://www.tes.com/teaching-resource/resource-13110856) 5. [Key Quotations](https://www.tes.com/teaching-resource/resource-13110868) 6. [Narrative Voice](https://www.tes.com/teaching-resource/resource-13110978) 7. [Setting](https://www.tes.com/teaching-resource/resource-13110874) 8. [Themes](https://www.tes.com/teaching-resource/resource-13110893) 9. [Critical Interpretation / Critics' Quotations](https://www.tes.com/teaching-resource/resource-13110848) 10. [Essay Help](https://www.tes.com/teaching-resource/resource-13110934) 11. [Essay Planning](https://www.tes.com/teaching-resource/resource-13110950) 12. [PEE Paragraph Practise](https://www.tes.com/teaching-resource/resource-13110997) 13. [Essay Practise (Gothic Atmosphere)](https://www.tes.com/teaching-resource/resource-13110962) 14. [L9 / A* Grade vs L7 / A Grade Example Essays + Feedback (Frightening Outsider)](https://www.tes.com/teaching-resource/resource-13110990) 15. [L9 / A* Grade Essay Example (Tension and Mystery)](https://www.tes.com/teaching-resource/resource-13110904) 16. [L8 / A Grade Essay Example + Feedback (Unnatural and Threatening)](https://www.tes.com/teaching-resource/resource-13110972) 17. [L6 / B Grade Essay Example + Feedback (Suspicious Atmosphere)](https://www.tes.com/teaching-resource/resource-13110984) 18. [L4 / C Grade Essay Example (Secrecy and Reputation)](https://www.tes.com/teaching-resource/resource-13110923) 19. [Study Questions / Exercises](https://www.tes.com/teaching-resource/resource-13110884) 20. [Essay Questions + Passage-based Questions](https://www.tes.com/teaching-resource/resource-13111001) Please review our content! We always value feedback and are looking for ways to improve our resources, so all reviews are more than welcome. Check out our [shop](https://www.tes.com/teaching-resources/shop/Scrbbly) here.

Your rating is required to reflect your happiness.

It's good to leave some feedback.

Something went wrong, please try again later.

This resource hasn't been reviewed yet

To ensure quality for our reviews, only customers who have purchased this resource can review it

Report this resource to let us know if it violates our terms and conditions. Our customer service team will review your report and will be in touch.

Not quite what you were looking for? Search by keyword to find the right resource: